GenePrediction:GLEAN_3605 Details

Name: GLEAN_3605
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1186854..1187819 (+ strand)
Length: 966
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1186854..1187819 (+ strand)
Length: 966
>GLEAN_3605 class=GenePrediction position=GCSC_156:1186854..1187819 (+ strand)
ATGCTTCCCCGGGCAGCGCGCTCGGCCGTGTCTGCCACGGCCACGGCGCCTCTGGTGCGCCTGCCTCTTCGGCTCGGCTC
AGCCTCATCCTGGAGCCACCAGAAACCATCGACAGCTTCACCTCTGCCAAGCCGGCCGAGCCGCTCTTTTTTCTCGCCAG
AAAACCAGTTCGGCAGCCGACAGTACTCGACCGCGTCTTCGCCTCCGCCCCCGTCTCGCAGGCGGCCCTGGATCCGCCCG
TCCACGGTCGTCTTCCTGCTGCTCGGCGCCGGCTTTGGCCTGCCTTTGTACGGCTTCGTCGCCCAGCTGGTGCCAACACT
GCCAGACCGCGGCTCGGCTGCCGAGGACAAAGCCCGGGTCGTGCTCGAGACCCGTGCTGCTCGGCTACCTTTGGTCGTGC
AGCTGACAACCGATCCGGCCTGGATCGAGTGGACCGTCGGCAGCCGATGGGCCAAAGATCACCAGCCATCATCGACCGAC
CTCGAGACCGATCTCGCATCCGATTCACCGCGCGAACGCCTCACCCGCGATGCTCTCGGTGGCGTTCAGGGCATGACCGG
CTACCACCGCGTCTTCCTCCACGAGCAGACCGGCGAGCTAGTCAGCGTCGTCTACCTCGGCAACGCCCTCTCCGGCTTCC
CGACTCGAGCCCACGGTGGTGCCCTAGCCACGCTGCTCGATGAGGCCCTCGGCCGCTGTGCTATTCACACTCTGCCCGCT
CGCACCGGCGTCACCGCCCGACTCGAGCTGCAGTACCGCCGCCCCGTCGCCGTCCCCGATTTCTACGTCGTCCGCTGTCG
CCCAGAGCTGCCGCCAGCATCGTCCCCCAAAGCCAGCCAGGACCTCCGGAAGCTGTGGTGCTCGGCCACGCTCGAAACAA
TCGCCGGCCAGACATGTGTCGAGGCTCGTGGGCTCTTTGTCGTTCCCAGGGGCTACAAGCTGGGGCGCGTGGAAGACCGC
TTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62