GenePrediction:GLEAN_3606 Details

Name: GLEAN_3606
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1204119..1205445 (+ strand)
Length: 1327
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1204119..1204149 (+ strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_156:1204228..1204485 (+ strand)
Length: 258
Type: CDS
Source: GLEAN
Position: GCSC_156:1204557..1205315 (+ strand)
Length: 759
Type: CDS
Source: GLEAN
Position: GCSC_156:1205378..1205445 (+ strand)
Length: 68
>GLEAN_3606 class=GenePrediction position=GCSC_156:1204119..1205445 (+ strand)
ATGACGGCTCCGTTTCCCACCAAGAAATGCGGTAAGACGGGCTCGGAGGGAGAGAACGGCAGAGCCGCAGACGCCTGGCC
GGCCGCTTGCTGACAGGTCTTTTGTCCAGGTGTCCTCGGCGCCACCGGCTCCGTGGGCCAGCGCTTTATCCTGCTGCTGC
AGGCACACCCGAGCTTTGTGCTGGTGGCCGTCGGTGCGTCCAGCCGATCGGCTGGGAAGAAGTACCGCGATGCCGTGCGG
TGGAAGCAGGCGACGCCGATCAGCGACCGCGTGGGCGACCTGGTCGTGCGCGAGTGTCAGTCCAGCGAGTTTGCCGACTG
CGACATTGTGTTTAGCGGTCTCGACGCGGACGTGGCGGGCGAGATCGGTAGGTCGCCATGAGATGGATCGGATGGATGTG
ATGACTTCCATCGTGCTGATATAATCATCACCCGCAAGAAACCGAGTTCTTTGGTGCCAACCTGGCGGTGTTCTCCAACG
CCAAGAACCACCGCCGCGACCCGCTGGTGCCGCTGGTGGTGCCATCGGTCAACTTGGACCACCTGGCGCTGATCCCGCAC
CAGCGGCTGCACCACCCGACGGCGCTGGCGGCCAGCCGGCCGATCGACCGCGGCTTCCTGGTGTGCAACAGCAACTGCGC
CGTGGTGGGCGTGGTGGTGCCGTTTGCGGCGCTGCAGGCGGCCTTTGGGCCGATCGAGGCGGCGTCGGTGGTGACCCTGC
AGGCTGTCTCGGGGGCCGGCTATCCCGGTGTCAGCAGCATGGACATCCTCGACAACGTGGTGCCCTTCATCTCGGGCGAG
GAGGACAAGCTCGAGACGGAGGCCCGCAAGATCCTCGGCACCATCAGCGCCGACGCTACTGCCCTGGCTGACCGTCCGGA
GCTCAAGATCTCGGCTGCCTGTAACCGCGTGCCGGTGCTGGACGGCCACGTCGTCTGCGTATCGCTGCGCTTTGTCCGTC
GTCCGCCACCGCCCGCCGACGAGGTGCGCCGCGTGCTGCGCGCCTACTCCAGCGAGGCCGATGCGCTCGGCTGCCCCAGC
GCCCCGCGGCCACCCATCGTCGTCATGGATGCTCCCGACCGCCCGCAGCCGCGGCTGGACCGCGATTTGTCCGGCGGCTA
CGCCGTCTCTGTCGGTCGCGTGCGCGAGGATGAGACCGGCCTCTTCGACATCAAATATGTCGGTCTGAGCCACAACAGTA
CGTTCCCCTCCATTTCTTGCGCTTGCCTGTCTGTAGACCACACCTCTGACCATGACCAGCTGTCATCGGCGCTGCTGGTG
CCTCTATCCTCAATGCCGAGGCCGCTGTCCTCAAAGGCTATGTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62