GenePrediction:GLEAN_3609 Details

Name: GLEAN_3609
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1227418..1227793 (+ strand)
Length: 376
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1227418..1227471 (+ strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_156:1227551..1227793 (+ strand)
Length: 243
>GLEAN_3609 class=GenePrediction position=GCSC_156:1227418..1227793 (+ strand)
ATGCTCGGCCACTGCTACGTCGCGCTGCTGGGCTGCGGCCTCGTCCTGCTGGTCGTGGCCGTCTCTTACCATCCGCCTTC
ACGGCAGGCGCAAGCCACAGGCGCCATATCCACACAAGCCACACTTACACAAGCCACACACACTTACATCTTCCCCCGTC
TCTACCCTGCTGTCAATTTCGGGCACCGTCCTGCTCGTCGCTGGTCTGCTCTGGGGAGGCTACCCGTACAGCTGGGGCCA
GGTCCACATGCTGGCACCCCTGCTGCTCAGTCTTGGGCTTCTGGCCGTTTTTGTTGCTTGGGAGGCCTGGGACATCGCAC
CCATAGCCCCCACGACCTCATCGCCACCGCTACCGTCCTCACCCTCGCCGGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62