GenePrediction:GLEAN_3610 Details

Name: GLEAN_3610
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1230156..1231200 (+ strand)
Length: 1045
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1230156..1230219 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_156:1230298..1230969 (+ strand)
Length: 672
Type: CDS
Source: GLEAN
Position: GCSC_156:1231025..1231200 (+ strand)
Length: 176
>GLEAN_3610 class=GenePrediction position=GCSC_156:1230156..1231200 (+ strand)
ATGAAGCTCTCTACGGCACTCGTGGCCGCCGCCACCGTGCTTCCCAGCGTATCTGCTTGGGGAGGTGAGAAAGGCCGCCG
GGCTCGAGTTTGTTCTTGTTCCTGATCGTACAGATAGCTGACACAAGTTTCCCCTTTCTTAGGATTCGGTCACATCACCA
TCGCGTACCTGGCCAGCGATTTTGTCCCCGCCGACACAGCGACCTACTTCCAGACGCTGCTGCACAACCAGACGGCCGAC
TACCTCGCCGGCGTGGCCACCTGGGCCGACAGCATCCGCTACACCAAATGGGGCCATTTCACGGGGCCCTTTCACTTTAT
CGACGCCAAGGACAGCCCGCCGGAGCGGTGCGACGTCGACATGGAGCGCGACTGCAAGGCGGCCGGCTGCATCGTCACCG
CGCTGCAAAACTACACCGCCCGCCTGATCGACAGTGCTGCATCCAGCAGTCTGAGCCCGCTCGACCGCGAGCAGGCTGCC
AAGTTTGTCGTCCACTTTGTCGGCGACATCCACCAGCCGCTGCACGCCGAGGACGTGGCACGCGGCGGCAACGGCATCCG
CGTCACCTTTGACGGCGCCCACCTCAACCTGCACCACGTCTGGGATACGAGCATCGCCGAGAAGCTTGTCGGCGGTGTCC
GTCGCCAGCCCTACGCCGCTGCCCGCCGCTGGGCCGACGTGCTCGCCGAGTCCATCCGTGGCGGCGCCTTCCACGACGAG
AGCGAGCACTGGCTCAACGGCCTCGACCTGGCCGACCCGGCCGCCACGGCCCTGGCCTGGGCGCGCGAGAGCAACGGCTA
CGTGTGCAGCCACGGTATGTTCTGTCCTGTGTCTTTCCTCCAGGCATGGCCGCCACTGATTCTGTCTAGTCTTCCCGCAA
GGCCCGACGGCCATCCGAAATCAGGAGCTCGGCTCCGACTACTACGAGAAAGCTGCTCCCGTCATCGAGATTCAGATCGC
TCGGGCTGGCATCCGGCTGGCTGCCTACCTGGACCGAATCGCCGCGCAGATCAATCAGCAGGAGTCGGCCACGGGCGAGC
TGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62