GenePrediction:GLEAN_3611 Details

Name: GLEAN_3611
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1232729..1234024 (+ strand)
Length: 1296
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1232729..1232943 (+ strand)
Length: 215
Type: CDS
Source: GLEAN
Position: GCSC_156:1233004..1233089 (+ strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_156:1233156..1233611 (+ strand)
Length: 456
Type: CDS
Source: GLEAN
Position: GCSC_156:1233711..1234024 (+ strand)
Length: 314
>GLEAN_3611 class=GenePrediction position=GCSC_156:1232729..1234024 (+ strand)
ATGATGTTCAAGTCCGTCCTCGTGGCTCTCAGCCTCAACGCCATGGCCAGCGCCTCAGTCATCAACCACAAGGGCATGCA
CCAGAAGCGGGCAGCCACCTCGTCCGGCAGCTCCGCGGCCAGCACCTGTCTAGACACCAATGCTCTGCAGACGGGCAGTT
TCGTGACCGGCCAGGTCAACGATGTGCCTTCAGGCGGCCAGTCCAACTCCAACACGTAAGCATTGTGGCAAACGAGCCCG
GACTGCTGCCCGGACCAAGCTGACAGACTCTGCAGGGACACGGCCAACTTTATCAACTTCTGCTCGGGCCAGACGCTGAC
GAACGGCCTGCAGGTCAAGGCGGGCTCCTGCAACGGCATCGGTAAGGCTCTACTGCTCTTCTTCGCCCTCGCGCTCTCTC
TTCTGCCCAGCTCCTAACCGGCTGCAGTCATGGGCAAGATCCCGGCCACGACCAGCATGGTCTCGACGGTGATCACCAAC
CCCAAGCTCAACGACAACCTGGACGCGAACACGACCTTCAACGTCACGCTCAACGTGGCCAACATGCAGCTCGGCTCCTT
CACCAACGCCACCAGCACGTACTACGCAGCGCCGCAGGATCTCAGCAGCAGCGGCGCCATCATCGGTCACGTGCACGTGA
CCGTCCAGGATGTCGGCAGCTCCTTTGACTTCACCACCCCGCTCGACGCCACCAAGTTTGTCTTCTTCAAGGGCATCAAC
GACGCCGGCAACGGCCAGGGCACCGTGACCACAGCTGTCACCGGCGGCCTGCCGGCCGGCAACTACCGCGTCTGCTCCAT
GACCAGCTCTTCCAACCACCAGCCGGTGTTGATGCCGGTGGCCCAGCGGGGTGCTCAGGACGACTGCCGCTACTTTACCG
TCGGTGGCTCCTCGTCGTCTTCGTCATCGTCGTCTTCGTCGTCTTCGGGCAGCGCGTCTGGCAGTGGCAGCGGTGCTGCT
GCAAGCTCAGCTGCCAGCTCAGCTGCCAGCAATGTCATCTCGACCGCCTCGACCCCGGCTGCTGTGACCACGGCTGCTTC
TGCCACCACGGCCGCGTCGACCTCGTCCGGCACCTCGTCTGCCCTCGGCGGCATCGAGGCGCCAGCCGTCGTCGACTCGG
GCGATGCCAACCGGCCGTTCTCGGTCAACGGCGACACGTTTGTCAACAAGTCGGCCGCCGTCCAGCGCGCGTGCTCGATC
CAGAACAACCAGTGCGCCAATGCGGTCAACTCGGGCACGCTGAGCGGCGTCACCGTGTCGGACTGCAACGCTCAGGATGC
TGCCTGCAGTGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62