GenePrediction:GLEAN_3612 Details

Name: GLEAN_3612
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1243710..1246666 (+ strand)
Length: 2957
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1243710..1245246 (+ strand)
Length: 1537
Type: CDS
Source: GLEAN
Position: GCSC_156:1245318..1245705 (+ strand)
Length: 388
Type: CDS
Source: GLEAN
Position: GCSC_156:1245808..1246666 (+ strand)
Length: 859
>GLEAN_3612 class=GenePrediction position=GCSC_156:1243710..1246666 (+ strand)
ATGAGCTCTTCTCGATATGCAGACGATACGGAGCGACAAGCGCCGATATCAGGATCAATACGTCGTGCCCGAGAGCGAGC
TGCGGCTGGGATGCCACGAGAGGACTTCACCTTTCCTACGAGAATGGGCCCGCCCCCACAACATCAGCAGTCGTCGATGC
GGCAGCCGTCGCGGATACCACCGCCACGGTCAACAGGAGGTCCTCTGCAGATGAAGAACGGACAGATCGGTGTCGCCATA
TCTAACCCGACTCCCGCAGCACAATGGCCCCTGGCTGGTCCTCTTGCAGCGCCATCCAATCTATCTTCCAACGATGCCGA
GCCATATCGCCCACCACCCGGGCGCTCACAACCACCGCAGCGTCCTCCACGACCGAGCAACGTGCCTTCGATTCTGGATG
CTTCTAGGATTCAGGATCTGACCCCCTCCGTCTTTCCGTATGGTGCCGGCACCTCGTCCAACACCTACAACAATAACTCC
TTTGCCGCCCCCCCTCCTATGGGGGACAGGCCAGGTCGGCGGCCCGACATGTATTTTGGCCAACAATCGATGGCATCCCC
GACATCGCGGCCGTCTACCGTCTCGTCCGTCGGCTCCATTCCGGACTTCCCGATTCCCGTGACGCCCGTCGCCATACTAG
CGCCCCCCCCAATACCAATTCAACCACGCCGCAGCGTCACCTTGGGCCCGCCTCCTTCAGCACGTCGGGGTGCGTCCTCG
TTCTACTCGAGCGCGTCGTTTGTGTCGCCCATCCCCGAGGAAAGCCCGAGATCACGCTCGCACACCTCTTTGGCATCCAG
TGCTGCAATGCCCGAGAGCTGGGGAACAGAATCATCACCATCGTTGAGCCCGAACTACACGGTGGAGTCCACCTATTACG
AAGACATTATTCCCGAAGACGGCCAGGAGTCGTTCGTTTTCGGCAACGGATATTACGAGGACGAGCGTGGGAGCGGTGCC
AGCTCACCGAACAGCGACGATGGAAAACGCCTTGTTCGTAGCGCAAGCTTGGGCAAGCGAGCCAAAGCCGCGTTAGTGAC
GACAGGGGGATCGCGCCTGAGTCAAAACAGCCAGTCACGAGCCTCAAACGCTGGGCCCTTCTTTGAAGACACCAGCTATT
CCAACCCTTCGGCGTCGTCTTCGGCGTCAAACATCACTGCGCCGCCGCGTGCGGCTCCGGCCCGCTCAACATTAACGGCC
TCCAGCATACTGGAAGCGTACGAAGCTGCAAGCGAGCTCAACCTGGCGCACCCTAACCGGCCACCGTCCTCTAATCCTTC
TAATTACAACAATGATAGCAACAGCGAGTCGACTCGCGATTACAGCCGACGATCAGCCATCCGCCGCCCACCGCGAATCG
ATCTGGACGCTGTGCGAAAAGCCGAGGCTCGTGGAAGCTTGACCAGCTTGCCTGATCTGATCAAGCGAGCAACCCGACTG
GCTGCCAGCTTGGATCGTGGCCACCGCCCAGCCAGCCGCATGAACGAATATAGTATGTCGCCAGGCATGTATGGGGCTAT
CGACAAGGAAATGGGCAGTACGTTCCCCTCTCCCACTCTTGGTTCTCCTAGTAATAGGCATGGATGTCCCGGATACTAAC
TCAAGCAGTTGAAAGAGACAAACATCAGTCTGGCCTGTCTGACATGCTGGCGGCCTTCCCGCCGCCAGCGCAGGCAGGTC
GACGAAGCTTTCGCGATCAAATCGGGTCTTGGCCATTGCCTCTTATTGGCGGAAGACAAGGAAACCTGTCGCCATATAAT
GGAGACTCAGACCGCATGGATGGCCAGCAACAGCGCAAGGGACGGCGCTGCTGTGGCCTGCCGCGTTGGGGGGCTCTTCT
TCTCCTATTCGTGGTCCTCGTGATTGTGGCAGCGGCAATCGTGATTCCGCTGGAATTCCTTGTTATCCACAAGAAGAGCA
CAAGCTCGGCAACGGCGAAGTGTGAGAAGCAGCTGATATGTCTGAACGGTGGCACCAACTTTGTCTCGGATGCAGGGTTT
TGCTCTTGCATTTGCAAAAATGGGTTCTCAGGCGTCGACTGCAGTAATTCTGTACAAGACGGCTGTACGATAACGTCTCT
GCCGACATCGACGAACAGCTCCGGGCTTACCAACATTACCATTGGCGATGCGCTACCGCGACTGATCGAACAAGCGCAGC
TCAACTTCTCGATTCCGCTGTCGGGCACGCAGATCCTGGCAATGCTGAACGCCGGCAATCTGAGCTGTACGGCCGAGAAC
GCTCTGGTGACCTTTGACGGCGAGACCGTTCGGCAGTCAGATGGGTCCACAGAGGTTAGCGACGCGGTGGTGAACGCGGC
GGTCAGCAAGAATGAGGACGTGGATGTTGCCAATGCAGTCCAGATTATGACGGTGACGGTCATGTCCGGGTCAAATGCAG
CCATCACGATCAGTCCATCGACCGAGACGGTGGTTGTCGGTACCGACACGAGTGGTACGCTGATAACCCAAGAGGGCTTG
ACGATCAGCATCGCGGCATCCGACTTGTTAAAACCGACTTCGACGACAACGACAACGGTGACGGTCACCCCGACGTCGAC
GGCATCTGGCGGCAGCAAGAGCACAAGCAAAAGCACAAGCACAGCGAGCAAGACATCCACCAGGAGCAGCACAACCACGA
CGGCGTCATCGGCGTCGACTGCCACATTCACGGTGACGGAAGAGGTGCTAGACTTTGCGCGGGTGGCGGTACTCTACATT
CTTCAGGAAGAGTCGCTGGCGAACGCAGAAACGGCACAGACGGCGCTGCAGAAGTTTTTCTCCAGCGCAAGTAATGGGGT
GCGAAACAAGACGACCGGGGTGACGTTGGAAGAGGCTCGCAACCTGACGCTGAGCAACGGCAACTCGGTCAACTTGGAGA
CGTTCAAGGTGGCGGTGACAGCTGGGTTGGGCGGCACGGTAAAGCGGAGGAGTGGAGTAGAAAGCTGGTTTGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62