GenePrediction:GLEAN_3613 Details

Name: GLEAN_3613
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1248766..1253402 (+ strand)
Length: 4637
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1248766..1249222 (+ strand)
Length: 457
Type: CDS
Source: GLEAN
Position: GCSC_156:1249287..1249431 (+ strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_156:1249624..1251731 (+ strand)
Length: 2108
Type: CDS
Source: GLEAN
Position: GCSC_156:1251790..1251910 (+ strand)
Length: 121
Type: CDS
Source: GLEAN
Position: GCSC_156:1252184..1253402 (+ strand)
Length: 1219
>GLEAN_3613 class=GenePrediction position=GCSC_156:1248766..1253402 (+ strand)
ATGTCTTACGACGGAGGCTATCCGGCGCCACAGCGCCCCTACAACGGACAGGCCGTGCCGCGACCACCTCCCCAGAGACA
GGTTCCGCCAGGATCTGGGGCCAGTGGGCCCCAGCAGTACGAGCCATACCAAGAGAACTTTGGGCGCGGAGGCGGCGGTG
GCAGCTATGAATATAGCGGTCCCTACGAAGACCAGGGCTATGGTTACGGCGGTCCTCAGCAAGGCGGCTATCCCGGCTCT
GGTCGAGGGGGCCCGCCTTCTATGACCGGTGGCCGCGGTGGTCCGCCGCAAAGACAGATGCCCATGGACGGCAACGGTCG
CGGCGCATATCCGCCTCGCGGCGGTGCAGCGGCTCCTGGTGGCCCCATGCGAGGTGGTGGCTATGCCAATGGGTCACCAG
GCCGCCAAGCGGGACCGCCAGGTCGCCAGAACTCTCAAAGCTCGTTGGATTCTTTCAGTACGTATCGCCGTCTCAGGCTT
CTATGTTCTCCCCTCTGTGCCTTGCTAACCAGGAACAGCAGGCCGTGGCCGTGGTGGGCCCCAGGCTCTCAATCCCATGG
AGCCCGGCTTCGGCGGAAATCCGTTTCCACCGTTCCCTGGTCAGCAGAACAAGGTGGACCGATTTGGTGATCAGTCCTTC
TTGGACGAGATGGCTGCCCTGGAATTGTCAGAGAGCCAATCCCGACAGCCGCCGACCGGTGGCAGGCCACCAAACGGCCA
AGGGCCACCATCGATGCGAGGCCCAATGGGGCCGCCCGGTGGTGGTGGAGGTGGTGGCGGTGGCTACGGCCCTCCACGAG
GATTGCAGAGAGCATTTACAGAGCAAAATAATTTTGGCGAACCCCTCCGCGGGCCCAGTCAGGGCTACGGCCCACCACGG
GGAGACTATCCCGACGACAACTTTGGGCCTCCAGGCCGGACTATGACTATGTCCTCGATGGACGACTCGCGTTTCCAGGC
ACTTCCTCCACGTGGCGATGCTGGTCCATATGACCCCTCGGGCAGCAGCATGGGCGGAGGCATGGGAGGCAACATGGGAG
GAAGCATGGGAGGCAGCATGAGGGGCGGCATGAGGGGTGGCATGAGAGGTGGCATGGGGGGCGGCATGGGTGCTGGCCGA
GGAATGGGTCCGGGTATGGGTCCGGGTATGGGTCCGGGTATGGGCCAACCACCACGGCCATCGACATCTCAAGGGTCACG
TCCGCCGCCTCAACGGATGTACCAAGGCGGCGGCGGCGACGGCTACGATAACGGTGCGCCAGGACCGGGGCAAGCTTACG
GTCAGCCACCACAGCAGCAGCAGCAGCAGTCAGCGATGTCCTTTGACGAACTCTACGACACATATTACTACTACTGGCCC
CGAAACAACGACGAATATGGAGCACCTGGAGGTGCCGAGGCGATGCACGACTTCGACCCAAACGTGCAGCACGACCAGCA
AATGTTTCAGGGGAACGGTGGTGGCATGGGACCAGCCCAGGCCCAGCCACAGCAAGGAGCGACGCGATATCCGGAGCTCA
GCAAGACCAAATCCCAACCCAATCTCCGCGAGCCGCAGGCCGCCGTGTTCGAAATGGCCGGCGACGTTCCGCCGATGCCG
ACGAACATGGGTGGCTTTCAGCAGGGGCCGCCGGGGCCACCGGGGCCACCAGGGTCGCATGCTCCGGGGACGGGTCTTCC
CTCTGGTCCAGCACCGGCAAGACAAGGCAGCGGTGCGTCGGCACGGTCAAACCAGAACCCAGACATGCTTCCTTCGCACC
CTACGCCGGTGCGGCCCGGGCTGATGCCTAACTCGGTGGCCAGCCACATTAGCAACATGGGCAGCAAGCCAGCACCGGTG
CGTAATTACGCAGGAACCGTGGGGATGCAGCCGGGACCATCGCCGACGCCGGGCCCTGGGCCAGCCGGTGCAGCAGGACA
AGCAGTGGCCCGGGGTCCAGGCCCAGCAGCAGAGGTGCCGGCAGCGGTGACGCCAGAGCTGCTCGAGCAGCTGCGGACCA
AAGTGAAGGCATACCCGAGCGACCAGGACACAGCGCTTCTACTGGCTAAGAAGCTGATGGAAGCGGTTGACGTGCTGGTG
CCGAAGCTGCCGGACCCGCGGGCACGGGGCAAGGCGCGCGAGCGATACACGATGGACGCGCACAAGACGCTCAAGAGGCT
GGCGGGCGCACAGAACGCGGATGCGATGTTCTTCATGGCCGACTGCCTCGGACGCGGGGTGTTTGGGGGCGAGCCAGACA
ACAAGGAGGCCTTCACGCTGTACCAGACGGCGGCCAAGCTGGGCCACGCGGCGGCAGCGTATCGCACGGCGGTGTGCTGC
GAGATCGGGCACGAAGAGGGCGGCGGGACGCGAAAAGATCCGCTCAAGGCGATCCAGTGGTACAAGAGGGCAGCGACGCT
GGGAGACACGCCGGCGATGTACAAGGTGGGCATGATCCTGCTCAAGGGCTTGCTGGGACAGCAGCGGAACCCACGTGAGG
CGGTGAGCTGGCTTAAGCGGGCAGCCGACCAGGCCGACACGGAGAACCCGCACGCGCTGCACGAGCTGGGACTGTTGTAC
GGGAGCGCGGAGCCGTTGGAATCGATTGTGCAGGACGAGGCGTATGCCCTGCAGCTGTTCCAGCAGGCGGCCGAGTTGGG
CTACAAGTTCAGCCAATTTCGAATGGGCTGCGCGTACGAGTACGGGCTGATGGGCTGTCCCATTGACGGGCGGCTGTCGA
TCATGTGGTACTCGCGGGCGGCGACGCAGGAGGAGCATCAGTCGGAGCTGGCGCTGAGCGGTTGGTATCTGACCGGATCC
GAGGGCGTGCTGCAGCAGAGCGACACGGAGGCGTATCTGTGGGCGCGCAAGGCTGCGGCAGCAGGCCTGGCCAAGGGCGA
GTATGCTATGGGCTACTTTACCGAGTCCGGCATCGGTGTCCCGGCGAATCTGGAGGATGCCAAGCGGTGGTACTGGCGAG
CAGCAGGTGAGTTTGGAGTTGAGACGAGACGAGACAATTCAAGAGACAAAACTAACAGCAATAGCCCAGGACTTTCCCAA
AGCACGTGAGCGGCTGGAGGATCTAAAGCGGGGCGGCAGAACAGGGCCACGGCAGCGCGAGCGCATTTCTCGCAGCAAGC
AGCAGGAGGGCGATTGCGTGGTGATGTAGGGGGAGAGGACAAAAGCACGTGCCCATTCCGGCTGGTCCTCTGGATGGCAG
CCAGCATAATGTAAGGAGGTGCTTTTCTAGGGTACTCGGACAGAGGCGAATCAATCCATATTAATCTTTATGTGAATCTT
TACATTGTGGGTCACATGACAACCGTAGATGTTTAGTCATGAAGTGGGTCCCAAAAGTCGATTCTTTTCCGGAGAACTTG
ATTCTCGGATCCTTCATGCCAGCTTCACATAGCCTCGACTCCCTCTCTCACTCGACAGGATGCGGTCTCTTGTGCGAATG
CATCTTGCGGCCAGCGCCAGAGTCAGTGCCAACAACAGCATCGTCAGCAGAGGTCTCTTAGCCGAGGCGCGGCGATGTGG
CCACGGTGGGAGCCGGCTGTCGTCGTCGATGTCGGCAGCGGCCCCGATAGCGCCGACGATGTCGCGGCAGGCCAACGTCG
TGTCGACATACGGAGCCGGCGATGGACATCTGCCGCCGCCACCACCAGCACCAAAGCCGGGTGCGGCCGAGCGCATGGCC
GAAGAGCGAGCGATCCGCATCGCCTATCGACAGGCAGCACGTGACGCGCTCACAAAACGGGACAGCCGGCTCTGGAAGGC
AGCCCGAGTGATAGGCGAGACGGAAAAGACAAAGGAGAAGGAAGCGTCGGCGCTGCTCATCGGGCTCGACAGCCGCACGG
TCCGCCACCCGACGACGCGCCAGCCGCTGCGGCTGCCGGCCCACAAGCAGCTGCTGGCACACGCGCTGGCCGTCGAGTGG
GATCAGCTGGCATCGGTACGCCAGGCATCACAGGGGCACCGCGTGCCGCTGATGTCGCTGGTCTGTCGCGCCGTAGACCT
GGAAGCCGAAGCCGAAGCCGAGGCGGAGACTGCAGCCAATGTCGGGCCCCTTCGAACAGCCCTCATCGCCAACCTGCTGC
GCTACCTCGACACCGACAGCCTGCTGTGCTGGGAAGACGAAGGCGGGGAGTCGCGTCGGGTAGCTGTCGGCCATGGCAGC
GCGTCGACTGTCCGCGAATCCCTCACGCTCCACCAGCTGCAACGACGGACGGCCGAGCCCATCCTGGCGTATGTGCGCGA
ACACGTGTGGCCCGGGCTCGACATCCAGCCGGTTCTGGGCGACGGCACCAACCCGTCGCGCCTCCTGCCCCGGCCTCATC
CCCCTCCTGTCCGCGAGGCTGTGCAGCGCTGGCTGCTCGCCCTCGACAGCTGGGATCTGGCTGGCGTCGAACGTGCCACT
CTGGCCGGCAAGAGCATCCTCGTGGCCGCCCGCCTGGTCGGTGGATGGCAGCAGCATCGCGCACAGCCAGGCCTCGTTCC
CAATGCCGCCTTTTCGGCCGAGGAAGCGGTTGCGGCCACCAACATGGAGATCGCCTTCCAGACCGCTCTCTGGGGCGAGG
TGGAGGATACCCACGACGTCGAGGCTGCCGACATGCGGCGACACTTTGGCAGTGCCGTGCTGCTGGTGGCAGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62