GenePrediction:GLEAN_3614 Details

Name: GLEAN_3614
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1253800..1255883 (+ strand)
Length: 2084
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1253800..1253842 (+ strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_156:1253904..1254139 (+ strand)
Length: 236
Type: CDS
Source: GLEAN
Position: GCSC_156:1254195..1254587 (+ strand)
Length: 393
Type: CDS
Source: GLEAN
Position: GCSC_156:1254656..1254913 (+ strand)
Length: 258
Type: CDS
Source: GLEAN
Position: GCSC_156:1254994..1255156 (+ strand)
Length: 163
Type: CDS
Source: GLEAN
Position: GCSC_156:1255216..1255883 (+ strand)
Length: 668
>GLEAN_3614 class=GenePrediction position=GCSC_156:1253800..1255883 (+ strand)
ATGGTGTTCCATCCGCCGGCATGGGTGCCTCAGCTCCCAATTGGTAAGCTCTGCTCTTGAAGTCGTATGCCTTCATCGCT
TGCCGTGCTGACCTCGGGAACAAGACCCTCCCGACTCCGTCACCATCGAGCAGTTTATGACCTCGGAGAAATTCGGCCGC
TCTCCCCTCGTCGAAAGCCGAAACCCCTTCACTTGCGGCCTGACCGGCAAGACACGCAGCTGGGTCGACCTGGTCCGACG
CGCCGACTTCCTCGCCCGCGCCCTCGGCAAGCGTCTTGGCTGGCAGCCCAATCAAGGCACCCCCTGGGATAAAGTCGTGG
CCGTCTTCTCGCTCAACTCCGTAAGTGCTCCGCTTAATGAACGACAGCACCGCGCTTGATCCTGACCCCGTCCAGATCGA
CTATATCCCCGCACTGTATGCCATCCATCGCTTCTCCGGCATCGCCACCCCGGCCAATGCCGCATACTCTGCCGCTGAGC
TCCAGCACCAACTGGTCTCTTCTGGCACCCAAGCTGTCTTCACCTGCCTGCCGCTTTTGGAGACTGCCCTCACTGCCACC
CGTGCCATCGGCATCCCCGACGAAAACGTCTTCTTGCTCGACTTCCCGGCCCTGACCCCGGACGCCCAGCAAGCAGCCGC
GGACGTTGGAAAAGTCCACTCCACCGTCGACCAGCTCATCGATGAAGGTTCTGCTCTGCCCCGCCTCGAACCCCTGCGCT
GGACAGAAGGCCAGGGCGCCCGCCAGCCCGCCTTTCTCTGCTACTCGAGCGGCACGTCAGGACTGCCGGTATGCCTCATG
TCATTCGGTGTCGTGCCCTCCCGCTCCGTTTCACTACTAACTTGTGCGCCCAACAGAAAGCCGTCATGATATCGCATCGA
AATGTCATCGCCAATGTCCTGCAGATCGCCTCCTCTGAGTCCGTCGGCCGCGAGAAAAAAGGTATCCGAACACAGGTCGT
GATCGGCCTCCTGCCGTTCAGCCACATCTATGGCCTTGTCGTCGTTGCCCACAGCACCACCTTTCGTGGGGACGAAGTCA
TCGTGCTTCCCAAGTTCGAGCTCGAGTCCTTCCTGGCCACAATCCAGCGATTTCGCGTCGAGATGCTTCACATCGTATGT
CCTTCCTACATCTGATCTGATCCCCGGGCTCGAGGCCGCTGGCAGTTATTGATTTCATCCTCGCTCTCCAATAGGTGCCC
CCCATCCTTGTCCGGCTGATGCAGACACAAGACATATGTTCCAAGTATGATTTGAGCAGCATCCGCTTCTTCTATTGCGG
CGCTGCACCGATAGGGGAGGAAACCATCGACGAACTTAAGAGATTCTACCCCCATTGGGTCATTGGTCAAGGATATGGTA
AGAGGAACCCCATGCCATAATCCGATCCTGCTTCCCGTTTTCCTGACACCATGCAGGCATGACAGAGACGTCCACCGTGG
TTTGCTCGACAAGCGAGCACGACATCTTCACCCGCTCGTCTGGATCGCTTGTCCAGGGTGCCAAAGCCAAGATTATCGAC
TTCGATGGCAAGGAGGTCTCGTCATACGACACCCCCGGCGAGCTGTATGTCCAGTCTCCGTCCGTGGTGCTGGGATACCT
CAACAACGAGAAGGCATCGGCCGAAACGTTTGTGAACCATGACGACGGCCGCTGGATCCGTACCGGCGACGAGGTCATCG
TCACAAAGGCACCTTCGGGAAATGAGCACATCATCATCGTTGATCGCATCAAGGAGCTGATCAAGGTCAAGGGCCATCAG
GTCGCTCCCGCCGAGCTGGAAGCGCATCTGTTGACCCACCCCGCTGTAGCTGACGCCGCCGTCATCCAAATCCCTGATGA
TAATGCTGGCGAAGTGCCCAAGGCCTTTGTCGTCAAGGCCGATGGCTATGCTTCAAAATCGGATGAAGAGCTTGCTCGGT
CCATCGCTCGTCATGTGGAGGAACACAAGGCTTCATACAAGTGGCTCAAGGGTGGCGTGGAGTTTATCGATGAAATTCCC
AAGACTCCAAGTGGCAAGATCCTGCGCCGGCTTCTGCGTGATCAGGAAAAGGCGAAGCGGAAGAAGGCAGGATCCAAGCT
TTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62