GenePrediction:GLEAN_3615 Details

Name: GLEAN_3615
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1263604..1264566 (+ strand)
Length: 963
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1263604..1264566 (+ strand)
Length: 963
>GLEAN_3615 class=GenePrediction position=GCSC_156:1263604..1264566 (+ strand)
ATGCTATATGGACAGTTTCCTCTTCAGGCAGAAGCTACCGACTTTGGGCCCGTGAGCAACTTGCGGAAAAAACTTTCTTA
TGGCCAGCAGAAGGCACGACCGAAGCCCCAAAAATACATTGCCAAATTTGATGGGGGGTTCCAGAAAGAGACCAAGACCA
AGAGACATGACAGAAAAGAGAGTGAGGAAGGAGAAAATGACGACCCGAAAACCCTGATTAGTGAACAGGCGCTGGATGAG
GAGCCAGAGGAACTACCGCTTCATCTCAGAGTGAATCACATCTGGGAGAGAGCTCCAGAGATAAAGGCCTTTTACAACTA
CTACGAGACTTGGATCAACAGCGAGGACTACTCTAGGTACTCTTGGGCTCGAGAGCCCTTGAAAGACATATTTCAGAATG
TCCAAGAGGTTGAATACGTTGTAAGAAAGGACCTTAGCAAGCCAGCAGAGCTTGTGGCTACGCTACGGCTCGTCTCGGCA
GACGAAGCCAAACGTACGGCATCCAAACTGGCCTCAGACATCTCCAAGGACTGGCTACAAAAGGTAGCAACCGCCAGAGA
AGTACTGGCCCACACTGCGACTTCCCAGACCGGACTAGACCAGCTTTCGAGCGATGCCGTCGCTGCTTCAGTGATTGCTT
CTGGTGTCCGGGCTCCTTTGCGTGACCAAGAGGCCAGTGACCATGACGAGGTTGCTATGCGTGATTTTGTGGATGATCGT
CCGCACCTGCAGTTTGTGCCCGGTCCCAAGTTAAAGAACAGAGCAATCATGCACGAATTCTTGGACAGTCTGCTGCGGTG
GTTTCCGCTGATGGAGGGGGCAGATGAGATGGGGCCCGAGCGGCAGATTGGCTATCACTGGCTCGGCACTCGTGTGCAGG
ATGGCTGGATAATAGTGACTCTGGCCAGGGATTCTCGCCTGGGCAGTTTCTGGACTTTGAAACACAACCCCGTCATGACA
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62