GenePrediction:GLEAN_3616 Details

Name: GLEAN_3616
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1267757..1268931 (+ strand)
Length: 1175
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1267757..1267768 (+ strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_156:1267849..1268931 (+ strand)
Length: 1083
>GLEAN_3616 class=GenePrediction position=GCSC_156:1267757..1268931 (+ strand)
ATGACGACGATGGTTTGTTTTGCCCGCAACGGGACTTGAACCCACTTCCAAAGGACTAGATTACCGTTGCTAACCTCTCT
TTTCTTGTACAGGATCTCCGCGTCGGTAACAAGTACCGCATCGGCCGCAAGATCGGCTCTGGCTCCTTTGGTGACATCTA
CCTGGGCACGAACATTATTTCGGGCGAGGAGATCGCTATCAAGCTTGAGAGCGTCAAGGCCAAGCACCCCCAGCTCGAGT
ATGAGGCCCGCGTGTATAAGTCACTGGCTGGTGGCGTTGGCATTCCCTTTGTCCGCTGGTTCGGCACGGAGTGTGACTAC
AACGCCATGGTCCTGGATCTGTTGGGCCCCAGCTTGGAGGACTTGTTCAACTTTTGCAACCGCAAGTTTTCGCTGAAGAC
CGTTCTTCTGCTGGCCGACCAGCTCATTTCGCGTATCGAGTACATTCACGCCAAGTCGTTCATCCACCGCGACATCAAGC
CCGACAATTTTCTCATGGGCATCGGCAAGCGTGGCAACCAGGTCAACGTGATTGACTTTGGTCTGGCCAAGAAGTACCGT
GACCCCAAGACTCACTTCCACATCCCCTACCGTGAGAACAAGAACCTCACGGGCACTGCCCGTTACGCCTCGATCAACAC
CCACCTGGGTGTCGAGCAGTCCCGCCGTGACGACATGGAGAGCTTGGGCTACGTCATGCTCTACTTCTGCCGTGGCTCGC
TCCCCTGGCAGGGTCTGAAGGCTGCTACCAAGAAGCAGAAGTACGACCGCATCATGGAGAAGAAGATGACCACTCCCACT
GAGGTTCTTTGCCGCGGCTTCCCCAACGAGTTTGCCATCTACCTCAACTACACGCGCTCGCTCCGCTTTGACGACAAGCC
GGACTACAGCTACCTCCGCAAGATCTTCCGCGACCTGTTCGTGCGTGAGGGCTTCCAGTACGACTACGTCTTTGACTGGA
CTGTGTACAAGTACCAGAAGAACGCCCAGGCCATCGCCCAGGCTGCTGGCGCTACTGATGACAAGCAGCGCACTGATGCT
GCAACCGGCAACCCCACGCAGTCCGGTGCGGTCAAGGCTGGCAACAGCTCGCAGATGATGTCGGGTGGCCGTCCCCGCAA
CGCCAAGATTGGCGACGTTCACGATGCCAGCCGGGGCCCTGCCGACCGTATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62