GenePrediction:GLEAN_3617 Details

Name: GLEAN_3617
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1270622..1272591 (+ strand)
Length: 1970
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1270622..1270800 (+ strand)
Length: 179
Type: CDS
Source: GLEAN
Position: GCSC_156:1270881..1272591 (+ strand)
Length: 1711
>GLEAN_3617 class=GenePrediction position=GCSC_156:1270622..1272591 (+ strand)
ATGGGCTCTCAGGCGGCCCCGGAACACGACACGATGGTCTCGTTTGCTTCACTAGATCTGCTGCTGCTGACGTTCAACTG
TGCCAAGTCGGCCATCGAGGTGCCGGTGTTTGCAGCCCATTTGCAGGAGGCCTTGTCGCCAAAGGAGACGGGCACGACAC
TGCCGGATCTTGTTGTCTTGTACGTGCAGAGCTGGACATTGGCAGCCGACGGCATGGTTCAGAAGCGTTCTTTGCACGCG
CTCTTGCTGACCAGATCAGCTCTCTGCAGGAAGTAGGCCCGCTTGGCCATGCCTTTGTGGGCTCGTACTTCTTGTCGCCG
TACCTGGCGCGGTTCGAAGAGGCGCTGAACCGGGCAGCATCGGAGCTGGACGGCGAGGGCGAGGGCGAGGGCGAGGGCGA
GGGCGAGGGCGAGAGCGAGAGCGAGGAGGAAGTTTCAGAGCAGACAGCTGCAGAGTCGGACACAGGGCAGACGCCGCTGG
TGGCGACACAGAAAGGCGGTGCCAAGATGAAGCCGTACCAGCTGGTGCGGCAGGCAAACGTGGGGATGACGGCAGTACTG
CTGTTTGCACGGGATGCAACCCTGGTGCGCAGCGTCGAGGTGGCCGAGTGCGGCTTTGGAGTGGCTGACATGGGAAACAA
GGGAGCCGTGGGTCTGCGGGTGGCTTACGGTTCGGCTGGCTCGGACGCATCGGAGCTGACGTTTGTGGCAACGCATCTGG
CGGCGATGGAGTGGAACGTGCGGCGGCGCAACGCCAACTGGCGCAGCATCGTGGCAGGGCTGACGTTTGGCAACCCGCAC
GACGCGATCGCGGCGGCCGGAGCAGAGCATGAGCGAGGGTCACTGCAGGCGCTGGGTCGTGGGCGACAGGGCCGGACGCG
CGACGAGGCGGCCAGCGCGCCCCAGACGCCCGAGGAGGAGGCCGAGGCCGATGCGGCCGACGCAGCCGGCGATGATGCCT
GGCTGCTGCTGGGAGGAAGTGAAGGGGTGGGGGGTGATGCTGGTGGCCGAGAGGAAGACGGACGAGCGGCCGGAACGGCA
GCGGAAACGACAGACAGCCTGGCTCTTCGTTCGGCCGACATCCGGCGGCGACTGCACGACATGTCCATCTTCCGGCCGGA
CAGCCTGCTGTTCGTCGCCGGCGACCTCAACTACCGCACGGAGGCGACGAGGCCTCCGGCCGGCGCCGTCTTTCCTACGA
CCAACACGTGGTCGGACTTCTTGGCACGTGACCAGCTCAATCAGGAGCGGCTTACCGGTCGCACCTTCCACGGCATGCGC
GAGGCCGTCATCACGTTTCCGCCGACGTACAAGTTTGACGTGCTCGAGGGAGCCGAGGCCGCGGTCGAGGCGCAGAACGC
GGCCGAGATCCGGGCGTGGCGGGAGACGCATGGTGAAGGCGAGGGTGAGGACGGCAGCAGGGCGCCAGTGCCGTGGAAGT
ACGCGTCGCATCGATGGCCCAGCTGGTGCGATCGGGTGCTGTACCTGGACGTGTCGGCGGCGGCGAAGCGGCGGTGGCGG
CGGAAGAATGGCAGCAGTAGCAGCAGCAGCAGTAGCAGCAGCAGCCAGCCGGAGGTGCAGGTGGCGCGATACGCATCGCT
GCCGGTGATGCGGACGAGCGACCACCAGCCGGTGTTTCTGCGGGCACGCGTGCCGCTGCTGGGCCGACGAGGTCGACAGG
AGGCCGACGAGAGCGGGAGCGAGAGCGGGAGCGTCGAAGAGGCAGAAGATGCGGATGCGGATGCGGTGAGCCCGGAAGGC
GAGGCAGGGGCCGTCCGTGATCCGCGCAGCCACCTGCCCGTGCCCATCGACACGGACGCGTGGGATCGCCGGACACAGGC
ACGACGGCGCGAGCTTCTCGCCGGCTGCGGCATGCTGCTGTTCAACACACGGGGTGGAGCGATTGCGATTGCCACGGCCG
TGGTGCTGACCGTGGGCACGTACTGGGTCTGGGTCGGGATGGTGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62