GenePrediction:GLEAN_3618 Details

Name: GLEAN_3618
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1277525..1279019 (+ strand)
Length: 1495
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1277525..1277527 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_156:1277721..1277750 (+ strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_156:1277853..1277945 (+ strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_156:1278012..1278937 (+ strand)
Length: 926
Type: CDS
Source: GLEAN
Position: GCSC_156:1278995..1279019 (+ strand)
Length: 25
>GLEAN_3618 class=GenePrediction position=GCSC_156:1277525..1279019 (+ strand)
ATGGTAAGTCCAACGCTGTGTCGTCTTCGTCTTCTTTTTGCCCTTGGTCAGGTAGCTGTCCGGTTGATCAGGTGGTCTGT
TGCCGATCACATCAGAGAGCTATCGAGCCAAGATGTCCAGCGACACCTGATACATATTCATTCCTCTACTTCATGAATGA
CTCATTCAGTGGCTAACTCGAACGCGCTGCAACCAGGCCGAGCTACACATTTCCAACACCGCTGCGGTAAGCTTAAGCAT
ACGAACCCCCCAACCGATCGGACGATTGGTGCCGGAGCTCCGCCGAAATACGGCCGTAGCAGAATGCTAATGCCACATTC
CCATACAGGTCGCCAAGTACCTCAACCTCGACCAGAAGGGCAGCCTCATCGCTGAGTACATCTGGATCGACTCCGAGGGC
CAGACCCGTTCCAAGAGCCGGGTAGGTTTCTCTCACCCGAAAGCGCGCGATGAGCAGCCCCGCTAATGTCGACCTCTCTC
GACGCAGACGCTCAAGGAGAAGGACTACTCCGTCAGCGACCTCCCGATATGGAACTTTGATGGCTCCTCCACCGGCCAGG
CGCCTGGTGACAACTCGGACGTGTACCTGAAGCCCGTGGCGGTGTTCCCGTCGCCCTTCCTCCTGGCCCCCAACATCCTT
GTCCTGTGCGAGTGCTGGAACGCCGACGGGACGCCGAACAAGTTCAACTACCGCCACGAGGCTGCCAAGTTGATGGAGGC
CCACGCGGCGCTTGAGCCGTGGTTCGGCCTGGAACAGGAGTACACCCTGCTGGACCTCAACGACCGCCCGTACGGCTGGC
CCGCGAACGGTTTCCCGGCCCCCCAGGGCCCGTACTACTGCGGTGTTGGCGCCGGCAAGGTCGTGCAGCGCGACATTGTC
GAGGCCCACTACAAGGCCTGCCTGTACGCCGGCATCAAGATCAGCGGCACCAACGCCGAGGTCATGCCGGCCCAGTGGGA
GTACCAGGTTGGTCCCTGCTTGGGCATCGAGATGGGCGACCACCTGTGGGTGTCGCGCTTCATGCTGCACCGCATTGCGG
AGGATCTCGGCGCCAAGGTGTCGTTCCACCCCAAGCCCATCCCGGGTGACTGGAACGGTGCCGGTCTGCACAGCAACTTC
TCCACCAAGGCCATGCGTGTCGAGGGTGGCATGAAGTTCATTGAGGAGGCCATCAAGAAGCTGGAGGGCCGCCACAAGGA
GCACATTGCCGTGTACGGCGAGGACAACGACAAGCGCTTGACCGGCCGGCACGAGACGGGCGCCATCGACCAGTTCAGCT
ACGGTGTCGCCAACCGCGGTGCTTCTATCCGCATTCCCCGCGAGGTCGGTGCCCAGGGCTTCGGCTACTTTGAGGATCGC
CGCCCGGCCAGCAACGCCGACCCCTACCGCATTACCGGCATTATTATGGAGACGTGAGTTTTGCTTCTCTGCTTCTTCCT
GTTCGCTCGAGCTTGTGCTAACCCTTCCAGTTGCTTCGGTGCTGTTGAGAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62