GenePrediction:GLEAN_3620 Details

Name: GLEAN_3620
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1285577..1287535 (+ strand)
Length: 1959
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1285577..1286811 (+ strand)
Length: 1235
Type: CDS
Source: GLEAN
Position: GCSC_156:1286878..1287535 (+ strand)
Length: 658
>GLEAN_3620 class=GenePrediction position=GCSC_156:1285577..1287535 (+ strand)
ATGCGTCCACGGCCCGGGCTCTTGCGCCGAGGGCCGCCGCGTGGCGAAGCAGCCGGCAGGCCGCCACGGCCTCGGTGTGG
CCGGCGGGCCTTTTCGTTGTCACTGGCGCGGGCGATGGAGTCGGCGCAGCCGTGGAGCCGCAGCGGACGGACGCGGCCGC
AGCTACCGTTCCTGGTGATCCCATCGCCTTCGCGGCCGTCGGCGGCGACCGCAGCACCGCAGCAGCGCTGCTTCACGACG
CAGCGGCGGCAGTGGTGGCGCTACGAGGTGCTGGCCTTTGCCAAGTACACGCTCTACGTCTGGGCCGCCGTCGGCTGCCT
CGTTGTCGGCCAGTTCGTGCTGCAGCAGGAGTGGATGGAGCAGGCCCACCCGACGCCGGCCGAGTGGTCCTTCTTGTCGC
GAATGCGTCTTCGGGGGGCCTTGAGCGAGCGGGACGGCGGCGAGGACGATGGCAGTGGCAGTGGCAGTGGCAGTGGTGAC
AGCTCTGGACAGCCGGACACCAGCAGCAACGACGAGCTGGCTACGGACGTACGCATCATCGATCACGTGCGCATGATTCA
GATCTTGCAGGACCTGATTGCACGTCTGGAGGATCCAGGGATCGACGGTGGGGGATTAGGAGCATCAGCAACAGAAACAA
CAACAACAACAGAAGCACCACCACTCCCATCCTTCGATATCCGCCCCAAGAGCGAGCCGTGGCGACGTGGCTACTTTGAG
GCGCTGCTGGCGGCAGCCGAAGCAGCCGAGCATGTCGAGGGATGGGTGCGCGACCGTACGCGCAACCTGGTGTGTCCGCC
CGACATGGTGGTTGGTCCGTCGAACCCGCATCCGCGTCCGCTACCGCCCGGCGCCTCGGGAGCCCCGCGTGAGGAGGACT
GCGAGCCCTGCTTTCCGGCGCCCGCCGTGCTGTACCGGAAGCTGCTGCACACCCGTGGCCTCAGCGTGCGCCAGCAGATG
GCCGCCGCCCTCGCCTTTGCCAACTACCTCGAGTACAAGCAGGACCTGACGGCGGCCGAGGAGGTCTATGGTCGGGCTAT
CGGACTGGTATCCAAGACGAGAGGAGACGCCAGGACAGCCAGCGCCTGGACGCGTGCCTGGACCGAGGATCCGTCTCTGG
CCGACGTGTCGCAGAACCTGCTGGCAACTCTGACGGCCTATGCGACCTTCAAGGCGCGCACCGGCGACGTCGCGGCCGCG
CTGTCCGTCTTTGCCGCCCTGCTGCAGGCTCGCCGGTCGTTGCCACCGAGCAGCAGCAGCAGCAGCAGCAGCGAGCTGTC
AGCGTCCGGGTCACCCACCAGCACGGATGCCAGCCTCTTCCGCCGCCTCGTCGCCCTCGTCACCCCGCCCGCCTATCCGC
CAGCCCCCGACGACGGCTTTGGGCCTCCCCTGCCAGGCCCCCAGGCCCGCTGCGACGAGGCCGCCCTGCACCTGCACGTG
GGCGAGATCCTCTACGCCACCGCCGGCGACAAAGACAGCAAAGACAGAAAAGAAAAGCGCGCCGAGGGCATCGCCTGGAC
TCGCGAGGCCGTCGACATGGCCGAGGAACAGCTGCGCGCCCTCCAGAACGAGGACGTCCGGGCGAAGAAGCGCCACGGAC
TGCTGCCCACCAGCCTGTTTGTGGACCCCCCCGATAACGGCAAGACTAAGGCTAGAACCTCCTGCCGGCAGTGTCTCGCT
ACCGGACTCGACAACTGGTCCGCCATGGTCCGCCAGCTGGCTCGCGACGAGGAGCGGCGCCAGACCGCAGCCAAGACGGC
CGGCAAGACAGCCGGCTGGCTCCCCTTTTGGCACTCGGTCGGCGCAGACGGCCAGACCGGCGGCAACGACGGCCAGAACA
AGCTTGGCCGGTGGGCAGCCGAGGAAAAGGTCATCCAGGATCGCAGACGTCGGGACAGAGACTTGCTGGAAGTGGCTCCG
CCTCAACAAAAAGGCCCGCTATCCATGCTTGTGGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62