GenePrediction:GLEAN_3622 Details

Name: GLEAN_3622
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1292670..1293669 (+ strand)
Length: 1000
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1292670..1292771 (+ strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_156:1293205..1293436 (+ strand)
Length: 232
Type: CDS
Source: GLEAN
Position: GCSC_156:1293548..1293669 (+ strand)
Length: 122
>GLEAN_3622 class=GenePrediction position=GCSC_156:1292670..1293669 (+ strand)
ATGGCTGGCAACAATGAAGCTCCCTACGACCCATACATCCCTTCTGGGCAGGCTGCATCCGCGCAGGGCGCCGGCGCTAC
CAGAACCCAGGCGCTGCAAGCAGTAAGTTCTACCTCTTTTTCGTCTCCCTTCTTTTGCGTCCTGTCCCGAGCAAAGCGCT
CCGTCGCTCCCGATGATCGCTGTTGCCGGCTGCACGTGGTCGATGTATCGTACGGTCGAGCCAGATGACGCCGATCGCCT
CTCGAATCGCCTGCTGCCATCAACCTCCACGTCGGCCTCGTCTCACTCTGCCGCCCATCGTCGTCTCACCAATCTGTCCT
TGGAGGAGGTCGATTGCGCAGCAGTCGCTGTGGCCGGTTGCCTAGGAGAGCAGACTACACAACATCCGGATAGGGGCGGA
AGCGATTACACATCGACACACCGACAGCCGTATGCATCGGCGACAACAGACGGACAGCGATGCAATGACGTGACGGAAGC
CGCCGGGCTGTCGCGGCTGCCCTGGTAAAGACAGTGCTAACCCGTGCTCCTGCAGGAAATCGACAACACGGTCGGTGTGA
TGCGCGACAACATCAACAAGGTCTCACAGCGCGGCGAGCGTCTCGATGCCCTGCAAGACAAGACAGACAACCTGGCCGTG
TCGGCCCAGGGCTTCCGCCGCGGTGCCAACCGCGTGCGCAAGCAGATGTGGTGGAAGGACATGAAGATGCGGATGTGCCT
GATTGCCGGCATCATCATCCTCATCCTGGTCATCGTCGTCCCAGCTGGTACGTCTGCCGTTGCCAACCGCTTCTTCTATT
CACGGCCTCCGGGTGCTAACTCATTACAGTTGTGGCTACCAAGCATTAACCTGGCCGGCTTCTCTCTTACTCTCTCAGTC
TCTTGTACGCATGACGAAAGTTGCAGCTTGGCCGACGACGAGATCGTTGGGTTCGGCAGCTGTCCTGAACTTACGAAATC
TTACGGATGGATGGCTAGGGTTATCGCCGCCGATGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62