GenePrediction:GLEAN_3624 Details

Name: GLEAN_3624
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1295897..1299448 (+ strand)
Length: 3552
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1295897..1296160 (+ strand)
Length: 264
Type: CDS
Source: GLEAN
Position: GCSC_156:1296296..1297406 (+ strand)
Length: 1111
Type: CDS
Source: GLEAN
Position: GCSC_156:1297460..1297511 (+ strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_156:1298044..1298228 (+ strand)
Length: 185
Type: CDS
Source: GLEAN
Position: GCSC_156:1298312..1298938 (+ strand)
Length: 627
Type: CDS
Source: GLEAN
Position: GCSC_156:1299045..1299448 (+ strand)
Length: 404
>GLEAN_3624 class=GenePrediction position=GCSC_156:1295897..1299448 (+ strand)
ATGAACGCGCTGGCGGTGGTGTTCCCGCCGAGTGTAGAGCGCCCATCGGCGACGCTGGCGACGCTGACGATCAGCAAGTC
AGGCTGGCTCGGCAACGTGGCCGACAACATCTTCACAGCGATCCGAAAGGACTTTCCGAAGCTGATCTGGACGGTCAACG
AGAACGACGAGAACCTGACGTGGTTCTTTGACAAGGCCGATGGCAGCATCGCGCGTAATGGCAACGTGCTCTTCTGGTAT
GGTGTCGAGGACGGCGCTGAGATTGTGCAGCTCATCAAGGAATTCTCTGCCAACGGCCGGGCGATGCTGGGCGACGCCAA
CCTGGAGGCGCGACTGCAGCGGGCAGCCACGGCGGCAGCAGCAGCAGGAGCCAGCGCCGACACGGCAGCAGCAGTCCAGG
CAGCCCAGTCACGGGCCCAACCAACCCAGGCGCGGGCTTTTTCGACTCTGGCACGGCGGCCAGTCGCGACGACAGCAACG
ACAGGAGGACCGATGTCACGTGCTGCCTTCCACTCATCGCGGACGCTGCGACTGGAGGAGACGACGAACCCGAACCCGCC
GCTGGGCCGACGGAACGCGACGAACGAGAAGGCGGCACGGATTGCACTGATCGGCGCGCGCGGCTACACGGGCCAGGCGC
TGATCGGGCTGCTGAACGCGCACCCGCACATGGACCTGCGACACGTGAGCTCGCGCGAGCTGGCCGGACAGCGGCTGGAG
GGCTACGACAAGAGCGAGATTACGTACGAGAGCCTCAGCCCGGAGGATGTGGGTGACATGGAGCGGCGCGGCGAGGTGGA
CGCGTGGGTGATGGCGCTGCCGAATGGGGTGTGCAAGCCGTACGTGGATGCGGTGGAGGCGGTGCGAGCAGAGAGATCGT
CGTCGTCGGCGAACAAGAGTGTGATTATTGATCTCTCGGCCGACTACCGGTTCGACTCGTCCTGGACGTACGGACTGCCG
GAGCTGGTGAAGCGCGAGACGATCCGGGATGCGCGGCGGATTGCAAATCCGGGCTGCTACGCTACGGCGGCGCAGCTGGG
CATCGCGCCGCTGCTGGCCCACGTCGGCGGGACACCGGTGCTCTTCGGCGTCAGCGGCTACTCGGGCGCGGGCACGAAGC
CGTCGCCGAAGAACGACGTGGAGCTGCTGACTAATAACCTAATACCGTACAGTTTGACGGATCACGTGCACGAGCGAGAG
ATTAGCAGCCAGCTGGGACGCAACGTCGCCTTTACGCCGCACGTGGCGGTCTGGTTCCAGGGCATTCACCACACGATCCA
CGTGCCGCTGCGGCAGTCGATGACGTCGCGCGACATCCGGCAGATGTACCAGGACCGGTACGCGGGCGAGAAGCTGGTCA
AGATCGTGGGCGAGCCGCCGCTGGTCAAGTCGATCCAGGGCAAGCACGGCGTGGAGATCGGCGGCTTTGCGGTGCACTCG
TCAGGCCGGCACGTGGTCATCTGCGTGACCATTGACAACCTGCTCAAGGGCGCGGCGACGCAGTGTCTTCGTAAGTGTCT
GGTCTGTTCTCTGTCCGTACAATTCCCCATGCTAACTGCGCAGAAAACCTGAATCTGGCACTGGGCTACGCCGAGTACGA
GGGCATCCCGATCATGTGAGGCACAGACAGAGCCTGGCGTTTCGCGGAAGGCAGTTGTGGGACGAAAACAACAAAAACAC
AAAAGGGTTCGCGTTGGTGTATCGTTTCTTGTACATAAAAGTAGGTTTGTATTGTCTGCGGGTAGTGCTGTTCCGCATCG
TTTAGAGCAGAGCCGGTGGTCCTGAGGAGAGAGAGAATTACGACAGCGAATACTGAGAGCAGTAGACCAGCTTGACTGGA
AGTCTGAGAAGTGAGAAGCAGAATACAGCTCGGAGAATCCTTTGAGAAGCCCGAATGAGTCATTAGTGCAGCTAAGGATT
TAGTGGGCCGCGGCATAGCCCCAGGCGGCTTCCGCATTGGGCATCCTCTGACTGCTGCTGCCAAAAGTGTCCAGTCAACC
TTGTGAGCGGCCTTGTCTGATTGGTGGGCCGACTGTTGGCTATGTGAAGAGTAGACGATGTCAAGGAAGGCAAAGGATTC
AGAGCTGGGCGGAAGGAAGCATAAAAGTAGAGATCTCTAAAGTAGCAACTCTGCTGAACGACATCAGAACTGAGCGAAAG
GAAGTACAGATCGGCGTGACGACTTACGACAAACGACTGATTGTCATGATTGAACTTGATGGGCGCACTGGCGAAGGCGG
CGGACAGCTCGTGCGCATTGCAGCTGCTCTGGCCGCCGTGACGGGCCAGGCAGTACGCATCTCCAACGTGCGTGGGAACC
GTCGGGGCGGGGGTAAGTTTTTGTTGCATCTTTGCGCTTTCCGCTTTCCACTTTCTGTCTCTCCGTCTCTCTCTCTCTTC
CTCACACACTCCCAGGACTGAAAGCACAGCACGTGTCTGCGATAGAGTGGCTCGCGATGGCGACCGGGGCCGCAGTCCAA
GGCCTGGCCGTGGGCAGCAGCACGTTCGTGTTCGAGCCGGGGCCGCCGTCGGCAGCCGGCCACGTTGTGCTGCGGCCGGC
CACGGCAGCTGCCAGCACGTCGCTGATGCTGCAGGCCGTGCTGCCGTACCTGGTCTTCCGGGGGGGCGACGAGGGGCTGC
CGGTCGTCCTGCACGGCGGCACGCACGTCGCCTGGGCGCCCTCGTACGACTACCTCGACCAGGTGCTCTTCCCGGTGCTA
GAGACGTGGTTTGGCATCCGGATGGAGCGCGCGCTCGAGGCCGTCGGCTGGAGCGCCGGACATGCCGGTCGTGTCCGGTT
GCTCGTCCATCCGATCGGCACCAACACGCTGACGCCGCGCGTGGCGACGCTGCACGAGAAGGTGGCAGCAACGGCCGCTA
CGGCCGCCACGATTGCTGCGGTCGACGCAACGATCCGGGCACCGCCAGAGGCACACGACCTCCTGGTCGAGGCGCTGGCA
CGGACGCTGGACCGAACGCTCGCCGGTGCGGACCTGCACCTGCGCACGATTGCCGACAGCGGCCGAGAGCGAAAGCAGAC
CGGTGCGTCGCTGGGGGCGCGACTACCTGGGGATGGAGAACATCCGGAAGCGGCCGGACGGCAGGCCGGGGAAGAGCAGG
AAGACGGAGAAGACGGAAAAGAGCGCAGAGGGCGGACTGCTGGGACTCTGCGAGCGGATCGCACGGGAGGTTGTGCAGGG
GCTGGCAGAGGAGGTCGCCGGCGGCGGCTGCGGCGACACGTTCCTGCAGGACCAGGTGGTCGTGTTCCAGGCCCTGGCAG
CCGGGCGGACCTCTTTCTGGCGGGAGGAAGCGGAGGAGGACGGATTGCAGGCATTGCGACAGCTGCAGCTGAGCGATGCC
GCAAACGAGGCCGCAAACGAGCGAAGCGAGAACTCAAACGAGAACCCAAACGAGAACTCAAACGAGGCGCCGTCTGGCCA
GGGAAGCTTACATGCACAGACGGCACGGTGGGTGACGGCACAGATGTTGGCGGTGCCATGGTTTCGAGAGGGAACCGAAT
GCGAGGGAGCTGGATGGAGAGGAGATGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62