GenePrediction:GLEAN_3626 Details

Name: GLEAN_3626
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1312863..1315038 (+ strand)
Length: 2176
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1312863..1312925 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_156:1312981..1315038 (+ strand)
Length: 2058
>GLEAN_3626 class=GenePrediction position=GCSC_156:1312863..1315038 (+ strand)
ATGGCAGAGCACTGTCAGCGCAGCATCCTGTCGTGTGCTCGGTGCCGCCGCCGGAAGATCAAGGTGTGTCGGCCAGGCCT
GATTGTCGAGTTCCCCGTCGTAAATGCTGACTAAGCAGTGTGATCGTCAGCTGCCGTTGTGCTCGCAATGTGTGGCCGCC
AAGAGCGAATGTACCGGCACGTCAACACGAGCCCGGGCGCCGTCGCAGCCGGCAGACGTCCCGCGCAGCATCGTGCAGCA
CCTCGAGTCGGAGATTGCCCGGCTGGAGACGGAGCTGTTGAAGGACGGCCAGCTGGAGGTCGTCCATGCGTCCGATATTC
TGCTGGAGATGGAGGGGGGAGGCGAGCCGGAATCAGTGCCAGCTCTGGCGAGCAGTGTGCCCTCTGCAACCTCGCTGCCT
CTCCGCGACTCCATCCTTCGAAGCGGAAGCCTGCAGTCGGTCATTGAGGCCACCCTGCCCTATGGCTCGGGCGCAGCCGA
CCTGCTGTCCAAAGTGCGCATGGGCCTGACCCCGTCGTCGGCCAAGGTGCGTGAGCGAAGAGGAGGAGGTTCTGGCTCTG
GTTCTCTTCCCGGTTCCGGCCCTCTTCCCACCAAAGGTCGCTCTCCCTCTTCCACCCCCACCACCCACTCCCTTCCGGCT
CCCATCCTCTGCAGCATCCCCTGGGATATTGTGCAGCGGCTTCTGCGCAAGTACCTCAACACAATCCAGCCTGACAGCCC
CTTTCTTGTTGCTGCTACCGTGGTGCATCAGTTCCAGGCTGTCGGCGAGGCCCTGCAGTCGCTCAAGACACAGACACCCC
CTCTTTCGGCCGACTTCCCCCCCCGTGTCCTCCCTTCTCACGACTTCCTCGTCGTCTATCTCGTCCTCGCTGTCTCTGTC
ACACTCGGTACCGCCAACGATGGCCACGAGGCCCGCTGCATGGCCCTTTCGGCTTCTCTCTTCGAGGAGGGCATCCCCCA
TCTGTCCGGCCTGGCTGCCTTCCCGTCCGATCTGGCCTGGCTGCAGACCATCCTTCTGGTCCTGCTGTACGCCACCGTCT
TTCCGCGTGCTGCTAATGTCTGGGTCCTTTCTGGTGTCGCCATGCGGTCCTGTCTCGAGCTGGGTCTGCACCGTGTCGAG
AGAACGGATCACCACCCCGATCATGACTACCACCCCGACCACGACCTTCCTCGCCGCGTCTTCTGGGCCGCCTATTGCAT
GGACCGCTCCATCTGCTCCGTCCTGCAGCGGCCACTGTCCACACCCGACGCCGCCATCAACGCCCGTCTGCCGGCTGGCC
GTCCGGATCACCATCCCTTTCTCAGCTCTGTCGCCTACCATCGCCTTCTATCCGAGATCTTGCACGTCCACTTCCACCGA
GAGCCCGTTCCTGCTGCTCTCTCTTGGGATGGCTGGCTCGCCAGCATGGAACGCCGTCTGCAGGAGTGGTATGACGGCCA
GGATCCGACTGAGCATCTCCACTCGGATCCCCCCACTCTCAACCACCCAGGCCACCCTCCCCGTCACACCCTCCCTCCCT
CCCTCATGCTCGCTCGAGGCCTCATGGTCCTCCATCGACCCTCTCCTCGCGTCCCTCAGCCGCAGCCGTGCTCGCTCCTG
CGCGCTTTTGAGGCTGCCACCTCTGCCGAGCGCATCCATCGCGACCATCTCTTGCGCGGCGTCTTTCGCCGGCCCTGGCT
GTCCGCCCACTATTCGCTCGAGGCTGCCACTGTCGTGCTCTTCTGTCTGCGTCACGGCTATGCTGCCATTGCTGCCCGCT
TCTCCGCCGCCGACATCTTCGACATGGCCAAGCTGCTGACCAGCAACCTGCTCGCTATCGCCTCTCACGGCTGGCCCGAA
GTCGGTGTCTATGCAGGCGCTTATGAGCGTCTGCTCGGACCTCTTCTCGAACGTGTCTTTGGTGGCCTTGGTGCCGGTGG
CAGCGGCCTCGACCTCGATCCTGCTCGCTTCGGCCCCGCACAGGACGCCGAGCTCACCCGCCTGCTCTACCCAGGCCCTG
CCCACCTCGAGAGCCTGCGCTTTGGCCTGCGTCAGCCCCAGCAGGAACTCAGTCCCTTCGACTTCAATCTTTTTATGATC
GATGACGACATGTGGGACCCTGGCCTCCTGCACAGTGACATTCATGACGGCATGGATGCTTGGGATATGCCCCAAGACAT
GGCCCTCGAGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62