GenePrediction:GLEAN_3629 Details

Name: GLEAN_3629
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1321029..1323431 (+ strand)
Length: 2403
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1321029..1321285 (+ strand)
Length: 257
Type: CDS
Source: GLEAN
Position: GCSC_156:1321337..1323431 (+ strand)
Length: 2095
>GLEAN_3629 class=GenePrediction position=GCSC_156:1321029..1323431 (+ strand)
ATGATTTCGTCCGCCTCTTCTGCCGGCACGCCCCGGCTCTCGTCCGCACACTCGCCGCAGTCTCTCTCTGCTGGCTGCGC
CACAGACTCCGCCACATCTACCCGTCATGCTCTCCAGCAGCTGCTGCCTACTTGCCAACGCTGTCGCCGTTTGCGTCGAC
GTTGCGACACCCAGCTTCCAAACTGCCGGCCATGCCAGCGCGCTGGTGCCGAGTGCACCATATTCGACCATGCCCTGAAG
CAGACGCTTCCACGCGCGTTCGTGTCCCCTCTTCAGCTCCTGTCTGAACATCTGTGCTGACCTAACAGATATGTGCAATC
ACTCCTCATCCGCGTTGAACATCTCGAAGCTGTCAAGAACAACGCAAACGGCCTGACGAGGTCTCCTGCTGCTTCTGTCC
CGATACCCATACCAACGACTGCCACTAGTCCATCGACCGTCTCTGTTGGCGGAAGCAGGCCCGATCGGCCTGATGCCCAT
CCTGCCACTACTGATGCCTCTTTCTCTCCCGCTTTCGCTCCCGACTCTTTCGACATCGTCGTTCCCTCTGCTGCCTCCGC
CGAAAAGTCACGCTACTGGGGCGCATCTTCCGTGTTCGCCCTGACTGTCGAGATCCTGCACAATGCCACGGCACGCGGCT
TTCTCACAGAGGCCGAGGCCGCCGGCGAGGACGGTGGCAGCCAACCGGCCTCGTTCGCAGACAGGTACACGCAAACCTCC
CATGCCCACACACACACACACGCCGACACCGAGGACAGCCATCATCCGAGCCTGGTCCAGGCAGAAGTGCCGCCCGAGGC
CGATATCCGCGGCCTGTTGCAGCTGTACCTCGTGTCAGCCAACCAGCTATACGGCTTTGTGGACCCGGCCCAGATTGCCG
CCGACCTGGACGTATACCTAGCGGTACGGAGGGGAGGAGGAGGTGGCGGCAAGCAGTCATCCTGTGCACCCTCTCCTCAC
CAAGTGCATCCCTACTTTCGCATCGCCATGATGTGTGCCATTGCCTGTGCGACACGTTCTCGCTACCGGCCACCCCGGGC
AGCCGAGAGCTTGGCCTACTACGCAGACGCGGCCGCGTACGTCGAAGAGGTCACGGCCGAGGTCTCTCCGGCATCGTTGC
AGGCGCTGTTGCTGCTCATCGTCTTCTGTCTGTTTTACCCGCGCCGTGGGAACGTGTGGAATCTGCTAGACTACGCCTGC
CGCCTGACCATTGAGCTGGGCTACCACACCGAAGGAAGTGATGACGAAGATGAGGCCGACGAGGCCAGGCGAGGCGAGAG
ACGTTGGCCTAGAGGCGACGGTCCCAACGATGCCGACAACACGGGCAGTCAGACCGAGAGAGAAGCTGCCCGCACGCTCT
GTCGGTCGACCTTTTGGGGGCTCTACGCCATCGAGCGCATTGTCGGCCAGTTGTTTGGCCGCGGCAGCGACCTTCCCGAG
ACCGTCATCACGGCGGCATATCCCAGCGCGCTGGCTGTTGCGCCCTTGTCAGTGGGTGCTGGTGGTCCTGTGCAGACTCC
CGCGCATGTCCCCGTGGCCATGCCGGACCAGCCGACGCTTCAAGCCATGAGCATCGCCCACCACTACCGCCTGGTCTATC
TGCGCTCCGAAATCTTTCGCTCGCTGTACCTGCCGGCTATTCCGGCCGCAGACGGTTACGATCCGAACCGGGACAGTCCC
GAAGACAACCTCCTCGGCCCCGGCCTCGGCCTCGCCTGGCTGCGCGACCGTCACCATACCCTGCTGGCCTGGCGCCACGA
ACTGCGCGATGTCGGCGAGGACCTCGCCGGGGTGGCCACGATCACCTGCGATGTCGGCTACGATGCCACCATGTGCTTCC
TGTTTCAACCGCTGCTGCTGCGCGCGTTACGGGCAACAGCCGAAAAGGCAACCACTACAACTAGCTCGACTTCTCTCCCT
GCTTCTGGTTCGGCTATGCATCCTCTCATTATTGCCTCCGACCCGTTTTATTCGTCCATTCGCCTTATCCGTACGTATGA
AAAGGTCATCCGCGCGCCTGAACACTCCGCCCTGGGCTGCTATCCCATGACGTTTATGAGTGCACATTATATTTATCTGG
CGTCCAGCACGTTGCTGTCCCATGCACTTTTGCGTCTTGATGACCGTGTGCACGTCTTGTCGCCGATGGGAGATGCCGAG
GCTGCGCCTCGACGGATGAGCTTCGAGACGCCCTTGCAGCAAGGCAACACCACCAATGCACCGGGCTTACATTCGTTCAC
TGAGCTTGACTGGGGCGCTTACGTCGATACTTCAAGCTCCTGGTTAATTCTGCTGGCCTGGTGTGGCGAGAGATGGCCGG
GTTTGTTAGGCATCCTACAAATCTATCAGCGCCTTTTTTCTCGCACTATCAAGCTTCTGATTCAGATGGGCATTGCTAAG
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62