GenePrediction:GLEAN_3631 Details

Name: GLEAN_3631
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1329096..1330176 (+ strand)
Length: 1081
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1329096..1329227 (+ strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_156:1329391..1330176 (+ strand)
Length: 786
>GLEAN_3631 class=GenePrediction position=GCSC_156:1329096..1330176 (+ strand)
ATGGCAGACAAAATTGATCTGCCAGACGACCTGCACGCGGCGGCCACGGCGCGGTTCGATAAACTACGCGAACAGGGCCT
CCTCTTTTATTTTCCCTCAGCGGGCGAACTTGTTCAACATAAGGATTTCACGGTAGGTTGTCTTTTCACTCTCTGCTTTC
TTCTCTCTCTTCTTTCCCTCTTCTCTCTTCTTTCCCTCTTCTCTCTTCTCTCCCTCTTCTCTCCTTCTCTCCTTCTCTCC
TTCTCCTCATCATATCCCCTATGCTTTCTCTCTTCCTCTTCTCATCCTCCCCCAGTTCGACTTTCGCATCTCGCCGTCCA
TCGCCCGCAAACCGGTCCTCGCTGCCGATGCGCCTGAGCGTCGCGGGCGTGGAGGGCCCTTTGTCGACCCAGATCCTCGG
TTTGTGGTAGCGCAGCCAGGCGCCGATCATGTTCTAGAGCTCAGCATTCACGCCATGGTTCGACCCCATTACGTGCTTCA
CACAAAGCACTTTAAACCACAGAGCGATGACCTTGGCCTGATTGACATGGCCGCTAGTTGGGCCGTCATGCAGCGTGTTG
CCGCCGCCGGCCACCGGCCCATGATGATCTACAACTGTGGTTACGAAGGCGGTGCATCCCAGGGCCACAAGCACGTCCAG
GTGTTTGCCGAGCCCGACCCAGGCTTTGTGCTGTTTCCTGAGACAGTATCGGCGTCAGCTTCCGACACAGCTGTCGCGCC
CCATGTCCGCTTTCTGCATTTTATTGCTCGGCTCGACGAGGACTCCGTCGATCCGCCACGCCTCCAGCAGACGTACGAGC
GGCTCATGATAAGTGTGCGCAGCGCCCACAGCGCCCATCGCGCCCGTCATCCTGAGGAGGCCCTGGAAGCTGACTGCTCG
GCGGCCGCGTACAACGTGATCCTCACGCCGCGGTGGATGTGTCTGATCCCGCGGCGCCGCGGCGGTCAGGACGGCACCGG
CGCCGGTGCACTGGGCATGCTGGGCGTGGTCTGGCTCAGAGACGCTCGCGAGCGCGCCCACTGGACAGACCTGGGCCTGA
CAGACCATCTCGTGTGGATGGGGCTGCCGCAGGAGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62