GenePrediction:GLEAN_3633 Details

Name: GLEAN_3633
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1339777..1340191 (+ strand)
Length: 415
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1339777..1339868 (+ strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_156:1340017..1340191 (+ strand)
Length: 175
>GLEAN_3633 class=GenePrediction position=GCSC_156:1339777..1340191 (+ strand)
ATGGCTCCTACACCCACAAATGATGATACCAGTTCCGTGAACAACGGCACCAAGTCTACCGGCTCTTGGGGGGGAGAAAC
GCATTACAGAGAGTACGTGAACAATGAAACTTATTCCAAAGAGAGTTGGTAGGGGATAATTTTTTAAAAAAAAAGGACGA
TAAAGGGTGTCTCGTGTGGTTACAGTCTAGCAACCGCTCGTTTGAACAAGAATCGAATGACTGACCGCAGCTTTGTGCAG
TTCAAGCACCAGGACGGACGGTGTCCATGGACTTCTTTTCAGCAGGCGAGACGAGGCTCCAGTGTCGTACCCGCCGGCCT
TGAAAGATGGCGCAGACAACCGCAACAATGACCTAAATCAGGTTATAGCCATCGTTGACCAAAAATTCCCTAGGCGGACA
CCACCACAGTCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62