GenePrediction:GLEAN_3634 Details

Name: GLEAN_3634
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1351226..1351948 (+ strand)
Length: 723
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1351226..1351578 (+ strand)
Length: 353
Type: CDS
Source: GLEAN
Position: GCSC_156:1351771..1351948 (+ strand)
Length: 178
>GLEAN_3634 class=GenePrediction position=GCSC_156:1351226..1351948 (+ strand)
ATGGCCTCGCAGAAATCGACTGAAGAGACCGATGCCACCTCTTGCCAGCTGCCAGTAGCCGAAACAGATGCAACCTCTGT
CGAAGGAGAATCTGTGGCGGCAGAAGGGCAACCTGGCAGCTTGGAGACACTAGCCATGGCATTGGACAATCGTTCCTTTT
TCGGCGCGTCGTCGATATCGGCAACAAACTTCAGAACATCCCTGGCACAACGGCCCGAGAGAGAGATGTCGCGTGTCGAC
CCCCTTTTTCTTCAAATCGGAAGTCAATTTGCCGCTCATGTCTCCTCCGGTACCCAGAGCTCTGCCCCTTTCGGCGGCAG
GCCGACAGTAGTCAACTTGAATAGCCGCGAGATGTAAGTGGGCCTTGATGAATCACGTTGTGACGGGAGAACTACTTCCG
CCTACAAACGGCAATATTCTGATCGGATCGCAGACTTGTCTCCATGATAGCTGAGATTCAACGTAGACCTCATAGCATGC
AAGTCTTCTGCATTCCAGGTCGTCCGTGATGGTTAGACCTGCTGCTAATGTCTATGCCTTCATAGGTTCTTGCTCAATGG
GTCCTTTACCTATACTTCCAATGCTGTTCTTGAATCCGACACGATGGGCCTTGGTGTTATCACGACTGAAGAACTCCAAA
CGACCGACGGCACTGCCGAATCCTCTGATGGCAATTCAGATGGCAATGGAGTCATTGCAGCGCAGTTCGAGGATACAGTA
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62