GenePrediction:GLEAN_3638 Details

Name: GLEAN_3638
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1396626..1401649 (+ strand)
Length: 5024
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1396626..1397249 (+ strand)
Length: 624
Type: CDS
Source: GLEAN
Position: GCSC_156:1397619..1401385 (+ strand)
Length: 3767
Type: CDS
Source: GLEAN
Position: GCSC_156:1401436..1401649 (+ strand)
Length: 214
>GLEAN_3638 class=GenePrediction position=GCSC_156:1396626..1401649 (+ strand)
ATGACGGCGCTCACAGCGCAGCAGAACAGCAGCAATCGACCGTCGCCGCTTGACGGCCGCCTCTCTTCGTCTCCCCACAA
CGTGCCGCACTTCAGGTCGGCCTCTGTCGCACACCCAGCTGCCCGAGGCAGCTCCGGGGCGTCAATGCCTTCCAAAACCG
AGACGACCCGCGCGGTGTCGTCGGGCGTGGTGAACCCTCTGGGTGCCCACCGAGTTGTCATTACGCAGACAACAACGACG
GGCGAGCCAGGCGGCAGCGCTCGTCTTGCTACGTCTAGTCCTGCCGCCCAGTCGTCAGCTGCTCTGGGCGCCAAGATGCC
GGCCTCGTCCGACCGTCTTGCTCCTGTCGGTGGCGATACCGAGTCCGATCGAGACTTTGCCGACCGGCAGCAGCAGCTGC
GGGAACGAGAGCGGAATCACCGCCGTGTGGGCAGCAAAACGGGCGGATCCCGGCCTGCCGCTGCCCGGCCGTCGCTCATG
CGGTCTAAAAGTGACGTCGCCCGGCCCGTGGAAAACAGCCCAGAGCTGCCTGATACCCTAGACGGAGAAGTCAGCCGCTG
GGGGGCCCGCCACGGCTTTGAGGACCACTACCAGTCGGAGGACATCATCTCGCATTTGGCCAGTGTAAGTGATGTCGTCT
TCGAATTGCTTTTGTTGCTTTTGTTGCCTTGTGTTTGGCAGCAGGCTGTGAGACCGTGTGACTCGACAGCCGTCTGTCTC
CGTGCTACTAGCTGGCAAGTCGCTGCCTAAAGGACTGTTGCGTAGCTTCTCTGCTCCTGCCTGCCAGCTGTCGGCGCTCT
TTCCTTTCTCGTGGCCCTTGAGTGATGCGCTTTCCCCACGTCCGAGCTCTGATTTCTACACGCACGTCTTCCTTCTTCCA
CATCACAGAGGACGTTTCACAGCGGCCAGGCATGGTTGGCTGAGAACATATCTCGTGTGTGTTGTTGTGCCTTTGTCGGC
TCTCCGCTAACCACATGTTCATGCGTCGTTCAGAACTGGTACATGTACTTTACCGACAAGCGGCACGAGTCGAACGGAAG
GCCACACGAGCCGACGTTTGAGCTGCAGGACTGGCGTATGCGCGACAGACTTAAGACCGTCTCGGCGGCGATTGCAGTCT
GCCTTAACATTGGCGTGGAACCGCCAGACCAGCTGCGGACAAATCCCGGAGCCAAGTTGGAGGCATGGCAGGACCCAACG
GTGCCTCCTGTGCAAAAGGCGCTCGAGAACATCGGCAAGGCCCTCCAGAGCCAGTACGAGACTCTTGCGATCCGCACACG
CTACAAGCAGTACCTAGACCCCTCGGTGGAAGAGACTAAGAAGTTTTGCATCTCGCTGCGGCGCAGCGCCAAGGACGAGC
GCGTATTGCTGCATTACAACGGTCACGGTGTGCCGAAGCCTACGGCGTCTGGTGAGATCTGGGTCTTTAATAAGAACTAC
ACTCAGTACATACCCGTTTCGCTGTACGACCTGCAACAGTGGCTGCAGGCACCGACCATCTTTGTCTGGGACTGCTCGGA
GGCCGGCAACATCCTGAGCAACTACCACCGCTTTGTGGAGAAGCACGAACAAGAAGAACAGGATGCCGCAAAGGCCGACC
CAAATTACGAGAAGACAAACTACCGGCCGTACATCCATCTTGCGGCTTGTGCTGTGAAGGAGAACCTGCCGACTAATCCG
CTCATTCCAGCGGACATCTTCAGCTCCTGTCTCACGACACCAATCGAGATGGCGCTCTGGTTCTTTGTGCAGCAGAATCC
GCTCAAGACAAGCTTGACCCCAGAGCGCGCCAAGAAGTTACCCGGACGCCTGCAGGAACGGCGTACGCCTCTTGGTGAGC
TTAACTGGATCTTCACCGCCATCACCGACACCATTGCCTGGACGACTCTGCCACGCCATTTGTTCCGGAAGTTCTTCCGA
CAGGACCTCATGGTGGCGGCGCTCTTCCGGAACTTCCTTCTTGCACAGCGGATCATGTCCGTGTACAACTGCCACCCCCA
GTCGTACCCAGAGCTTCCGGACACGCGTCAGCACCCGCTGTGGGCCAGCTGGGATCTGGCGGTTGATCAGGCTCTCGGCC
AGCTCCCCATGCTCGAGAGACGGGAAACGGACAATATCGAATACGAATACCAGAACTCGACCTTCTTCACCGACCAGCTG
ACGGCGTTTGAGGTGTACTTGACACGAGGCGACGCGATGCTGCAAAGGCCCCCGGACCAGCTCCCCGTCGTACTGCAGGT
GCTGCTTAGTCAACAACACCGTGTGCGTGCCCTCATTCTCCTTGGGCGCTTCCTCGATCTGGGCCCCTGGGCCGTACAGC
TCGCTCTCAGCATTGGGATCTTTCCCTATGTGTTGAAGCTTCTCCAGTCTGCTGCGTCTGAGCTGAAGCCGGTGATGGTG
TTCATTTGGACGCGTGTGCTAGCCGTTGACATTTCCTGCCAGCAGGACCTCATTAAGGACAGTGGGTACAACTACTTCGC
ATCCATCCTCAAGCCGTCGGAGGGCCTCCCTGTGGTCAACACGGACGAACACAAGGCCATGTGCGCGTTCATTCTGGCCA
TGCTTTGCAAGGGCTACAAGCCGGGTCAGACAGTGTGCAACCAGACGGACATCATGACGTTTTGCCTGATCCATCTGCGA
AACGAGGAAAACCCGCTTCTGCGGCAGTGGTCATGCCTCTGCATCAGCCAGTTGTGGCAGGATCTTCCGGAGGCGAAATG
GCGCGGCATCCGAGAGAATGCTCCCTTGAAGCTCTCGTACCTGGCAAAAGACAGTATCTGCGAGGTTCGCACGGCCATGC
TCCATGCTATGACGACACTGCTGGGCATACCGGAGCTGACCGACGAGGTGGCCCGTGTTGAGGAGTCGATAGCCTGGACG
GTGCTTGATCTGACCAACGACGGCAGTCCGCTTGTGCGCAAAGAGCTGCTGGTGTTCATGTCCCACTTCCTGCTGCGGTA
CGAGAGCAGGTTTCTGGTTGCCGCATACGAGCATCTGCAGGAAGAGAAAGAACACCTTACTTTCCCGCCCGAAAACACAT
CTTCGGGCTACAAGACGGGACTCCACCATGTCGGTCCGGAGAACCGCAACCGTGACGGCACGGCAAAGGAGCGCGCTCAC
GGGCTGTCACAGAGCACGATTTTCGCGACCTACTGGAAGCACATCCTGATCCTCTCTGTCGATCCCCATCCCGAAGTGCA
GTCGCACGCTATGACCATTATCGACTATGCCCAAGAGATGCTGCTTCACTCGGTCGTTGGCGCCTACGCACAGACCCTCA
TGGATGAGATCGAAAGAAAACACCGACGTCTATCGAGGTCAGGTCCCCGGAACAGCTCAACCCTTATGGCAAGTGTTTCG
GACCTCGGCAGCAATAGCCTCAGCGGCAGCACAAACTGTATCGGGAGTGGCGCCGGTAACGGAGCTGGTCCGCTCGGCAA
CGGAAACACGAACGGCAACATGTCGCCTCAGCCGTCGCCAGGCCTTCTGCGGCGGACGGTCAGCACGCTTTTCTCGCCCT
TTTTTGGCAGCGACGGGCCGGGTGCCGGCCAAGCATCGGCTGGCATGCCGACAGGACCGTCCGGACTTGAGGCACCAATG
TCGCCGGGGCTGCTGCGATCGTCTTCGACGTTTCAGCGAGGTTCTGGCAGAACACGTGGGCTATTCGGGCCCGATCGTGC
TTCTGCGCCGCCGGAAGACAGCGAGCGGGAAACAACAATGTCTGCGTACAACGTGGCCAAAGAGCCGGTGTCGCCTGGTT
TTGAGCAGCGAGCGGCAACGGACGTGCCTTGTTTGCCGCTGGTAAGCACGTTCTTGGAATGGTCGACAGAGTACTTCCGC
GAGCCACAGATGCGAGCGATGGAAGCCGAGGAGCCGGGCAGCACAGAGTACAACGAGCGGCTGTGGCGGCGATCGCGAAA
CGAGGGGATCCTGCGGGAAACACAGCCACAGAAGCCGTTTGCGGGATCCCACAAGTGGAACAACCAGCTGGGAATCATCA
ACAACGGGTCGCAGCCGTCACGGATGACGTTCCATCAGTTTGAGGACCACCTGGCAGTGGCGGACGATGGAAACACGATT
CAGATCTGGGACTACAAGCGACAGGGTCGACTGAGCCGATTTTCCAATGGCAACCCGCCGGGATCGCGAATCAGCGACAT
GAAGTTCATCAACGAGGACGACCAGGCGTTCCTGATGGCGGGATCGTCAGACGGCGTGCTGCGGGTGTACCGACGCTACG
ACAGTGACAAGCAGGTGGAGCTGGCAACGGCATGGCGGGCGCTGACGGACATGGTGCCGAGCAACGTGCACGCGGGCATG
GTCTTTGACTGGCAGCAGGTGACGGGCAACGTGCTGGTGGCAGGCGACGTGCGGGTGATCCGGGTGTGGAACGCAGGCCA
CGAGTCGTGCGTGACGGACATCCCGGCACGATCGGGATCGTGCGTGACGTCGCTGACGAGCGACCAGATGACGGGCAACA
TGTTTGTGGCCGGATTTGGCGACGGAGCGGTGCGGGTGTTTGACACGCGGCTGCGACCTCAGGAGGCGATGGTGCGCAAG
TGGAAAGACGACGCAGACCGGGTTTGGATCAAGAGCGTGCACATGCAGCGTGGCGGCCAGCGGGAGCTACTGTCGGCAGC
ACGCGACGGCAAGGTGAAGCTGTGGGACATTCGTAGCGACCATCCGCTGCGAGTGATGCAGACGACGGGACAGACATTGC
GGACAGCCAGCACGCATGAGCATCTGCCGGTATTTGCGATGTGAGTATTGGTTCATTCCCCCATACACGTATCATGCTAA
CACTGCACAGAGGCACATCGTCTCGGGAGGTCAAGGTGTACAACTTTGACGGACGAGAACTGTCCCGGCTGGAGCCATAT
TCGGGCTTTCTGCAGAGCCGCAGCACGCCCATCTCGGCGACGGCATTCCACCCTCACCAGGTGACGCTGGCATGTGCTGC
ACGGGGCGACTACCACATCAATCTTTTCAGCTGCTCGCAGGAGCGGGCCGTTGCAGCGGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62