GenePrediction:GLEAN_3640 Details

Name: GLEAN_3640
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1406895..1407789 (+ strand)
Length: 895
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1406895..1406959 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_156:1407036..1407789 (+ strand)
Length: 754
>GLEAN_3640 class=GenePrediction position=GCSC_156:1406895..1407789 (+ strand)
ATGACAGCACCGGTGGACCAGCGGATAGCGGTTCCGGTGGACGACCCCAATGCGGACACAGAATGGTGAGTCTGGCCGAT
GGCAGTACAGGTGTCCGTCTGTGGCCGGCAAGCTGACCGTGTGGCGGGTTCGTGCGTGCAGGAACGACATTTTACGCAAG
CACGGCGTCATCCCAGAGAAGCCGCCGAGCCCGACCCCGATGATCGAGGAGGCCATAGCCGAGGGCCGACGGCTGGCGCA
CGAGAACCGGCTTGAGGGCAAGGACCTGGACGAGCTGGACGAGTTCGAGGACGTGGAGGACGAGGACTTTCTGAACGCGT
ACCGCCAGCAACGCATGCAGGAGCTGCGCAGCCTGACGAAAAAGGCCGTCCACGGCAGCGTGTACCCGCTGACGAAGCCC
GAGTACGGCCGCGAGGTGACGGAGGCGTCCAAGGGACATGGCGGCGACAACGAGACGACAAGCACGGGCGTGCCCGTGCT
CGTGCTGCTGACATCGTCGGCCGGCACCAACATCGAGTCGCGCGTGCTGTCGGAGCTGTGGTGCCAGGCCGCCGCCGAGT
ACGGCGAGGTCAAGTTCTGCGAGATGCGGGCTGAACAGGCCATCGAAGGCTATCCGGAGCGCAACTGCCCGACCATCCTG
GTGTATCGCAACGGCGACATTGTCAAGCAGGTCGTCACGCTCGTGATGCTCCACGGCGTCAAGACGAACATGCTCGACAT
CGACTCGCTGCTGGTCGAGGTCGGCGCCGTGCCCGACAACGACATGCGCGTGATCAAGCGGCGACGCACGGCCGAGGACG
CCGAAGAGGAGCGTCTGGCCGGCACTAGCACCATCCGGTCAGGCTTCGGTGGGACGCCGGCCAAGGACGGCGACGACGAC
GACGACTGGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62