GenePrediction:GLEAN_3643 Details

Name: GLEAN_3643
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1419695..1422025 (+ strand)
Length: 2331
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1419695..1421799 (+ strand)
Length: 2105
Type: CDS
Source: GLEAN
Position: GCSC_156:1421878..1422025 (+ strand)
Length: 148
>GLEAN_3643 class=GenePrediction position=GCSC_156:1419695..1422025 (+ strand)
ATGCGACCTCTCAAGCGAGCTGCACACGTCCGGCTGCCATTGCGGCACCCAATGCGGCTGCTGGCCACAACAGCAGATTC
GCCCTCACCAGCGACAGGCCCGGTCGGCTCTCTGCTCATTGCCAACCGCGGCGAGATCGCCTTGCGCATCCACCGTACTG
CCACGCGCATGGGCATCCCGACCACGACGCTGTACACGGCAGTGGACGCAACTGCACAGCACGCCCGAGCATCACCTCGC
AGCTTGGCATTGGGCTCGTATCTGGATGGCGACAAGATCATTGCGCTGGCACTGCAGCACGGTATCCAGGCTCTGCACCC
GGGCTATGGCTTTCTGTCGGAGAACGCAGCGTTTGCAGAGCGCTGCGCAGCTGCGGGCATCACGTTCGTGGGTCCGCCAG
CACAGGCCATGGCCGACATGGGCGACAAGGCACGCAGCAAGGCCATCATGCTGGCAGCCGGAGTGCCGTGCGTGCCCGGA
TACCACGGACCGGACCAGGCCCCCGAGCAGCTGGCGGTCCATGCGGCCAAGGTCGGCTATCCGGTGCTTCTCAAGAGCGT
GCGTGGGGGTGGCGGCAAGGGCATGCGCATCGTGCAGACGCCAGACGAGTTTGAGGCGCAGCTGCGCAGTGCACGGGCAG
AGGCGCGGGCCAGCTTCGGCGACGGCGGTGAGGTCATGCTGGTGGAGCGGTATATTGTGCGGCCGCGACACGTCGAGGTG
CAGGTGTTTGCGGACAAGCACGGCACTGCCGTCGCTCTGGGCGAGCGTGACTGCAGCATTCAGCGGCGCCACCAGAAGAT
CCTGGAAGAGTCGCCAGCTCCAGACCTGGGCGACGACCTGCGCCACGACCTGTGGGACCGAGCTCGCACGGCTGCGCTTG
CGGTGGGTTATGTCGGCGCTGGCACGGTCGAGTTCATCCTCGACCGCGACACGGGCGAGTTCTTCTTCATGGAGATGAAC
ACGCGGCTGCAGGTCGAGCATCCGGTCAGCGAGCTCGTCACTGGCACAGACCTGGTCGAGTGGCAGCTGCGCGTAGCTGC
TGGCGAGCCGCTGCCGCTGATGCAGGACGCCATTGAGAAGCGCATCAGAGATCGCGGCCATGCTATCGAGGCGCGCATCT
ATGCCGAGAACCCGGAGCGCGACTTCATGCCGGACTCGGGCTGCCTCGTACATCTGGCCACGCCGGCCGTGCAGCCTGTT
GGCACCAACAACGAAGAGGCTGACGTGCGCATCGACGCCGGCTTCGTGCAGGGCGACACGGTGTCGGAAGCGTACGACGG
CATGATTGCCAAGCTGATCGTGCGCGGTGCCGACCGCAAGCAGGCCATCCGCAAGCTGGAGCTCGCCCTGGAAGAGTACG
AGGTGGCCGGACTGCACACCAACATTGAGTTTCTCAAGCGGCTGTGTCGGTCGCCTGCGTTTGTCGCCGGCGACGTCGAG
ACGGGTTTTATCGATAAGTGGCGCGACGAGTTATTGGCGCCGCGCGCCGTGGCCGACGAGACGTATGTGCAGGCGGCTCT
GGCCTTGTTTGTAGCTGCACGGCCCGGCGGCTTGGCCTGCAGCTTGCACGGCCAGCCGCTCGGATTTGGTGATGCCGGTG
GCGGTGGTACGGCTGAACGTAGCTTCGCCTTTGAGGTGGTGGACGCCTACAGCGACCGAGCCGGCGACGTGGTGGAGGTA
GCATTGACGCAGACAGGATGGCAGCGGTTCCGGGCGCGGGTGTGGTGGCGGGACAACAAGTCGGGCAGTGTTACGTACGA
TGATGTCTTGCTGGATTCATCGGCCGTAGAGCACAGACAGGCAGATACCACGGCGACAACCACGACCACCCGGCTGACGG
CCTTTTATCCCACGACGCGCGCAACGTCCACAGTGGTGCAGCAGCAGCTGCAGCAGCAGGCAGAAGACATTGGACCCGTG
CAGCTGACCGTCTTCCAAGGCGGCACCAAGACGGAGCTCAAGCTGGCTCCGCCGGCGTGGTACGCAAAAGTGCGTGGGAC
CGACGAGTCGGCCGGGCTGTCGGTGGTGGCGCCAATGCCGTGCAAGATCCTGCGCAACGAGGTGTGTGTGGGCGAGACGG
TCGAGAAAGGGGCTCCGCTGGTCGTGTGAGTTATGTTTTCGTCTTTGTCTTTTGTTTTTCGGCTTCTTTTCTGCTGCCTG
TGACATCTGCTGACAATCGGCAGCATCGAATCGATGAAGATGGAAACGGTCATCCGGTCGCCGCAGCAGGGCATCGTCAA
GAAGCTGGCACACAAGGAGGGCGACATCTGCAAGGCAGGGACGGTGCTGGTGCTGTTCGAAGAGGCTGAAGAGGCCGAGG
AGGCCAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62