GenePrediction:GLEAN_3653 Details

Name: GLEAN_3653
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:81813..82898 (+ strand)
Length: 1086
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:81813..81867 (+ strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_113:81927..82516 (+ strand)
Length: 590
Type: CDS
Source: GLEAN
Position: GCSC_113:82593..82898 (+ strand)
Length: 306
>GLEAN_3653 class=GenePrediction position=GCSC_113:81813..82898 (+ strand)
ATGGCTGTGTGGGAAGTCAACGGCAAGATTGCCATTGTGACCGGCGCTGGTTCTGGTAAGTATCTTGCCTGTCTTCTCTG
TTTGCTAGTCAACCTAGTAGCTGACGGTGGGCAGGCATCAACCACCATCTGACAAAGAGGCTCCTTCAGTCGGGATGCTC
CGTCGTGATGGCAGATCTGGCTCTGCGGCCGGAAGCCGAAGAGACGCTGAAGGAATACCCTCATCCCCCAGTTGAGGCTG
GTGCTGCATCGGCCATCTTTCAGAGAACCGACCTGGTGGACTGGTCGCAGATCAACCTGCTTTGGGAGACTACTCTCAAG
ACATTTGGACACGTCAACCTGCTCGTCAATGGCGCAGGCCTCTACGAACCTCCATTCAGCGACTTCTGGAACCCCCCAGG
CGTCTCGCCCCTAGCCAAGGATCCTACAGATGCCCAGGTTGGCATGTACAAAACCTACGCAGTCAACACGATCGCCCCCG
TCAGACTCGCACAGATTGCGATTGAGTACTGGCTCCGCCCCGAGAATCGCGTCCTCGGTGGTAACATTCTCTGGATCGCG
AGTATGGCAGGCTACATCCACGGACTCCTGACTCCATTCTACTACTCCAGCAAGGCCGCAGTGGTCAGCATTTGCAAGTC
CCTGGGCAGTCTGAACAAAATTGCAGGCATTCGAAACGCCGCCATTTGCCCTGGCGTGGTTGATGTGCGTAATTCCATTT
CCCATGCATGCCCATTTCTACTGCAACTTTATAGAGACTGACCAAAGAACTGGCTACCAGACACCCATTTTCCACGCGAC
ATACAGCCGCGAACGCGTGCAGGCTGATGATCTTATGTTGACCGTAGACGAGCTAGTCGACGTCGCCATGAGCGGCATTC
AGGACCCCAAGTACGGCGATGGCAACATAATCGAGGTCTTCTGCGGGGGCACAAAGGAGGCCCATGAAGTTGTCGTTCGC
GACGTCCCTCTAGAAGCCATCTACAATATGGAAGGCCTAGTCGGGCTGGCTGCGGGAACGCATATCATAACTAAACAGGA
AGCGTTTGAGAAGCAGCTCACAGAGAAGGGGCTGGTATTCAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62