GenePrediction:GLEAN_3654 Details

Name: GLEAN_3654
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:88739..89554 (+ strand)
Length: 816
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:88739..88970 (+ strand)
Length: 232
Type: CDS
Source: GLEAN
Position: GCSC_113:89049..89554 (+ strand)
Length: 506
>GLEAN_3654 class=GenePrediction position=GCSC_113:88739..89554 (+ strand)
ATGTCGATCACCGAGCAGGACTCTGCAACTGCCGAGCACGGCTGGGCGGCCGTGCCACGAGATCCTAGTGTTGTGCTCTT
GGGAAAAGAATTCCTTCACGAGCCGAAGCCGCTGCTTGTCCAAGACATGCTATTACCGACGCTCGATCCGCTTGTTGTCA
AGACCCAGGCGTATGCCAAAGAGAAGCTGTCCCCCCAGACCTACAACCACTCCATGCGTGTGTACCATTATGGTAGGGTA
TACGACTGCTTGAGGATCAGAAAAATGGTCATGGAGGTTTCTTGGCTGACCGTCATGATTCTTCCACCAGCCACTGCTAT
CCTGCTACAGCAATTTCCCGACAAGGCCCAGGACATGTCGCCTTCTACACTCGCCTTGACGGCGCTGCTGCACGATATCG
GCACGACACACGACAATCTGCGTACGACACGCTTGTCCTTTGAATTCTTTGGCGGCTTGCTTGCCCTTGACCTCGTCGGC
AAGCAGCTGGGCGCACCGCAAGCGCAAGCCGAGGCTGTGGCGGAGGCTATCATCCGCCACCAGGATCTCGGAACGACGGG
CAGCATCACCTTCCTGGGCCAGCTGATCCAGCTGGCCACCATCTACGACAACATGGGTGGCAATCCGGCATTAGTGCACG
CGCAGACGTTGGAAGACGTGGTTCGGATGTATCCGCGCAACGGCTGGAGTCGGTGCTTTGCTGCGACGATCCGCGAGGAG
AACGGGCTGAAGCCATGGGCCCACACGACGGCGCTGGGCGAGGAGGACTTTCCGAATGGCGTGCTGAACAACAATTTGAT
GGCGCAGTTTGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62