GenePrediction:GLEAN_3655 Details

Name: GLEAN_3655
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:90181..91141 (+ strand)
Length: 961
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:90181..90275 (+ strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_113:90352..90901 (+ strand)
Length: 550
Type: CDS
Source: GLEAN
Position: GCSC_113:90968..91141 (+ strand)
Length: 174
>GLEAN_3655 class=GenePrediction position=GCSC_113:90181..91141 (+ strand)
ATGTCTTCCGCCAAAGCACTCTCTCTCAAGGAAGAAGGCAATCGCCACTTCCAGGAGGGTGACTATGCCGGCGCTGATGC
ACTTTATTCCAAAGCGTAAACACAGCAACGGAGCTTCATGTGTTGGAAATTCGTCGACCACGCTTAACTAACCCCAATTC
TCAATCTACAGTATTATTGCTGATCCCACCAATCCGACGCTCTACACCAACCGGTCGATGGCTCGCCTGAAGCTCGATAT
GTGGGACAGCGTTACTAGCGACTGCAAGGCGTGTCTTGAGATTGCTCCGAACAACATGAAGGGCCATTACTACCTAGCAC
AGGCCGAGTTGGCCCTCAAGGCATTCGACGACGCCGTCGCACATGCAAAGTGCGCCCACGAGATTTGCATTGAATCCAAC
GACAAGTCACTGACAGCGGTCACTGCGCTTGTTCTTCGGTGCAAGAAAGAGCGCTGGGAAGATCGCGAGAGGCGACGCTT
GCGTGAGGATGCCCAGCTCGAGGCACAGGTCCTATCTCTGATGGAGACGGAGCGTGACCGCGACCTTAAAAACGCCGACA
ATGACGGCGACCGCAAAGAGATCGCGGAAGAGTGGGAGGAAAAGCTTAGCCATCTTAGCGACACATTCGAAAGGGCCCGC
GTTGAGTCCGAGAAGCGGAGGGAAGTACCGGACTGGGTCATAGATGACATTACATTCGGAATCATGGTCGACCCTGTCAT
CGTGAGTTGGAATGAAATATTACCCACTCTCCAGCTTTCTTCGTTGTTCATAATAACTAACCCTCAGACCAAAACTGGAA
AATCATACGAACGCTCGGCCATTCTAGAACACCTAAGACGCTCAAGCACGGATCCACTCACAAGAGAAACGCTTACACCA
GCGGATCTGCGGCCCAATATCAACTTGAAACAGGCCTGTGAGGAGTTTCTTGATAAGAACGGGTGGGCGGTAGATTGGTG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62