GenePrediction:GLEAN_3657 Details

Name: GLEAN_3657
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:103469..105640 (+ strand)
Length: 2172
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:103469..103757 (+ strand)
Length: 289
Type: CDS
Source: GLEAN
Position: GCSC_113:103828..103973 (+ strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_113:104055..104671 (+ strand)
Length: 617
Type: CDS
Source: GLEAN
Position: GCSC_113:104755..105640 (+ strand)
Length: 886
>GLEAN_3657 class=GenePrediction position=GCSC_113:103469..105640 (+ strand)
ATGTCTCCTCCTGGCCTCAGTAGCCTCAATGGGGACGGCATGTCCGCGGCTTCAGCATCCGCATCCGCAGCAAGTAGCAG
CGGTCGTCGGGCCACATCGAAGGATTTTGTGCCATCGGTTGTTAGCGATGAAGTGCTCGAGACGGAATTCCTCATTATCG
GCGCTGGTCCCGCAGGATCGTCCCTGGCTTGCTTCCTGGCATCATACGGGCTGAAAGGGATCGTGATCAGCGCGGCACCG
GGCACGGCCAACACGCCGCGCGCTCATATCACCAACATGGCCGCTCAGGGTGGGTTATGGATGGCATATAGGAGACAATC
GGAGTCCAGACGCCTGGCTGACAGCAGGGGAAACTGCAGAGTGTCTACGGGACATCGGTCTCGACCAGGAGACAACAAAG
GCGGCGTCAAAGGGAGCATGCATGGAGCACAGTCGGTGGTGCCACAGCATGGCTGGCGAGGAGTATGCGCGTATATACTC
TTGGGGCAACGATCCGCAGAGAAAGGTCAGTAGGTGAGCAGGAGGGTAGGCAGTCTGGGCTCGGGCTCGACCACGGCGAC
GACCGACTGACAGGCCACACGCACAGGGCGACTATGAGACGGCGAGCCCGTGCGAGCCGGTGGACTTGCCGCAGACGTTG
CTGGAGCCGATACTGGTGAGGCGTGCAACCAGCAGCGGATTTTGCGTGCGCTTCGACACGGTCTTGGCGTCGTTTGAGTA
CGACGAGGCCGCCCAGCGCTACACGGCCACGGTGCACGACCGCGTGACGCGCCTGGCATATCGGATCCGCACACAGTATC
TCTTTGGGGCCGACGGTGCGCAGAGTCAGGTGGTGCGCCAGCTGCAGCTGCCGCTTCTCCGGAAGCCAGGCCAAGGCCTC
GCGGTCAACGTGCTCGTGCGAGCTGACCTGGCCCATCTCGTCGGTCCTCGTCGCGGAAACCTCCACTGGATCATGCAGCC
GGACCGCGAGAGCCCAGACTTTGGCTGGACCTGCCTCACCCGTATGGTCAAGCCGTGGCACGAGTGGCTGTTCATCCTGA
TGCCGAGCCCCGGGGCCGATCTCGCGGCCGAGCAGCCCAGCCACGAACAGTGTCGCCAGCGGGTGCAAGATTTCATCGGC
GATGACACACCCGTTGAAGTCCTTGACGTTTCGCGCTGGCACATTAACGAAATCGTGGCCGAATCGTACTCGGTCGGGGA
TGTGTATGCTTTTTTCGTTCCTCTTTCATTCGGCACGCCTTTGCGTCTTGTCGTAACTGCTTACTAATCCATCCATTACT
CATCAGCTTCTGTCTCGGCGACGCCGTCCACCGTCACCCGCCCATGAACGGCCTCGGCTCCAACACGTGCATCCAGGACG
CTTTCAACCTGGCCTGGAAGATATCATACGTGCAGCGCGGCTGGGCCGCCCCGGCGCTGTTGGCCTCGTACAGCGTTGAG
CGCCAGCCCGTCGGCGCGGCCATCATCGCGCGCGCTAATCAAGGCCTACGCGACCACCAGCCCGTTTGGGAGGCCCTGGG
CATGTTTCCGCCAGACATCGAGGCCCGCCGTGCCGTTCTGGACGAGCTGCGGGCCCCTACTGCCGCCGGCCGGGAGCGTC
GCAAGGTCTTCCAGGCGGCCATTGAACAGACCGCCCACGAGTTTCACGGCCTCGGCATCGAGATGGGCCAGCGGTACGAA
AACAGCACGGCCGTGTACACGGCCGACGAGCCGGCTCCGTATGCACTGCCGCCAGGAAGCAAGGTCGCCGAGGACCCCGT
CCTTTACTATGCCCCCAGCACGTATCCCGGTGTGCGGCTGCCGCATGTCTGGCTCAACCGCGCGACTCCTGAGAAGGCCA
CCTCGACCATCGACCTCGCTGGCCACGGCCGCTTCGTGCTCTTCACTGGTATTGGCGGCCGTGACGCTTGGCGCACTGCT
GCCGCCGCCGTCACCGCCCAGCTCGGCCCGCCTCTCGACGTCCACGCCATCGGCTTCCGCCAGGAGTGGGAGGACGTATA
TTTTGACTGGGAGCGTCTGCGCGGCGTCGAAGAGTCAGGCGCCGTGCTCGTGCGGCCAGACCGCTTCGTGGCCTGGCGCT
GTCCAGAGGTGCTTGACAGCCCCGATGCCTGTGCACTGAAGCTGCTCCAGGTCATGCGGGCCGTGCTCGGGTTTGGCAAT
GCAGACAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62