GenePrediction:GLEAN_3658 Details

Name: GLEAN_3658
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:108574..113182 (+ strand)
Length: 4609
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:108574..108589 (+ strand)
Length: 16
Type: CDS
Source: GLEAN
Position: GCSC_113:108648..108775 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_113:108826..109921 (+ strand)
Length: 1096
Type: CDS
Source: GLEAN
Position: GCSC_113:109981..110918 (+ strand)
Length: 938
Type: CDS
Source: GLEAN
Position: GCSC_113:111292..111350 (+ strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_113:111670..113182 (+ strand)
Length: 1513
>GLEAN_3658 class=GenePrediction position=GCSC_113:108574..113182 (+ strand)
ATGCCGGGAAACTCTGGTAATCAACCACCAAGTACTTTTAGAACAATGGGCTTGCTACTAACAGCTGTTGCCAGACCCAA
ATACTATCCGCATCCTCGTCTCGACAGACAACCATGTCGGGTTCGAGGAGAGGGATCCCATCCGAAAGGATGACAGCTGG
AAGACTTTTGACGAAATCATGAACCTCGCTAGGACTGAGGACGTACGTTCCCCCACCACCTGTGTCGCTCGGTGCAATCT
GACAAGTCCTAGGTGGATATGGTTCTGCTAGGCGGTGATCTCTTCCACGACAACAAGCCCTCCCGGAAGTCCATGTACCA
GGTCATGCGAAGCCTTCGACAGAATTGCCTGGGCATGAAGCCGTGCGAGCTCGAATTTCTCAGCGACGCTGCCGAGATTT
TCGAAGGCGCCTTTGGCCACGTGAACTACGAAGATCCCGACATCAATATAGCTATACCTGTGTTCTCTATCCATGGGAAC
CATGACGACCCCAGCGGCGACGGTCATTACTGCTCCCTGGATCTTCTCCAGGTTGCCGGTCTCGTCAACTACTTTGGGCG
GGTCCCGGAAGCAGACAATATCAAAGTCAAGCCATTGCTGCTCCAGAAGGGTGGGACGAAGCTGGCTCTCTTTGGCATGG
GCAACGTTCGGGACGAGCGCATGTTTCGTACCTTTCGGGATCACAAAGTGTCCTTCTACCGCCCCAATCAGCAGGCCGAC
AATTTCTTCAACCTTATGGTCGTCCACCAAAACCACCATGCCCACACGGCCACCAGCTACCTTCCGGAAAACTTCCTCCC
GGATTGGCTTGATCTTGTGATGTGGGGCCACGAGCACGAATGTCTCATAGATCCCACGAAGAACCCTGAAACGGGATTCC
ATGTCATGCAGCCTGGCTCGTCTGTTGCTACGTCGCTAATTCCTGGAGAAGCAGTGACAAAGCACGTTGCCATTCTGACA
ATAACTGGGAAAGAGTTTGCTGTACAAAAGATACCACTAAAGACAGTGCGTCCCTTTGTAACTCGCGAACTCATCTTGGC
CAACGAGAAAAAGTTCAAGGATCTGGCAAAAAAGAAAGATAATCGTGCAGAATTGACAAGGCGCTTGATGGCTGTTGTTG
AGGAGATGATCGAGGAAGCAAATGCCGAGTATTTCGCTCTTCACGATAGGGATGAGACAGAAGAGGATCCACCGCTGCCA
TTGATCCGGCTGAAGATCGAGTATACCGCTCCCGAGGGTGGCAACTTTGACTGCGAGAACCCTCAGCGATTTTCAAATCG
CTTTGCTGGCAAGGTCGCTAATGTCAACGATGTTGTCTACTTCCACAGAAAGAAGACAGGAGTATCTGGTACGGATAACG
CCGTGATGGCCACATATCTCTGCCCGAATGCTTATGTTGTTTGTTAGGACGAAACAAGACTGATCTCACACTTCCCGAGA
TAAACGGCGCTGAGGAAGGAGCTGATTTCAATGCAATCAAAGTTGAAGCGCTTGTTCAGGAATACCTAGCGGCGCAGTCG
CTTAAAATCCTTCCTCAGGGCGAATTTGGCGACGCAGTGAACCAATTTGTCAACAAGGACGACAAGCATGCCATGGACAC
GTTCGTCAGCGGATCTCTCGCCAACCAGCTTAGAGACCTGCTGGCATTGGGTGCCGAGGACGACGATCTTGACGGAGCCA
TGCAGAAAATACGAGACGAGCGGGAACGGCAGTTCCAGGCCGGCCTAGTAAAAAATGGACCTAAGCGGCAATACAAGCCG
AGGCCTGACGATTGGGACTCTGACATGGAAGGCCACTGGGAAAACAATACCGACGCACTTATCTCAAGTGCTGCCAGTGT
ACCACAATCGGCAGCTTCGCGGCAAGGTGGTAATACCGGAGCGCAACCTAGCACAAATCAGAACGACGAAGATTCGTCTA
TGGACGATTTCGACAGCGTACAACCTGTAGCCAAGTCGACGGCAGCTAGGAGAACCGCTGCCACGCGGACCACCAAGGCT
GTAGCACCACGGCAACCGGCGGCAGCGAAGAGAACATCTGCTCCAAAACGAGCTGCTGGCAGGAAGAAGGGGCCATTTGA
AGATTCAGACGATTCAAACGAAGACGAAGTTACAATAGAAGATGAGGCACAGGACAATGAACAGTCGCAGACAGCACGTC
GTTCTCGTGCTGCGCCAGCTCGGCCGGCAGGCCGCATGCGCCAAACAACCCTGCAGCTCTCCCAACCAGCACCGAGACAG
CAGCGGCCGTCGCGGAAGACGACACAACAGACGCAGCAGTCGCTGGAGCTGAGCGATGATGAAATATCCGACGACGATGA
CTTTGAGCCGGCACCGACTACAAGGGTTCGGAAGAGATAGCGTCAAAGTATTAGTAATACATTTGCCTTACTAAGTGAGA
AAGATCACGTGTGCCTGATATTCCGTACAAAATAGCCTGTGGCGCAGATTACCAGCAAAGCGCCACGCTGTATCGCCGGC
CAACCTACGTTGATCTTGAGGCGCGGCGTTCGTGGACGTCCATGAGCACGGCTGACCATCGAATTTCATCGAAAAACACG
ACAGAAGCAAGAGAAATTAAAGTGCGCCTTCGAATGATGTTATTGCTGGGCCTGTGCGACAAATAGCCTAACCAAACTGT
TGCGCTGCCGCGAATCGCGACTGTTTCTCGCCCCGCCCATCTGATATCCCCCTTGTTCTGGACGTCGGACTGCTGCAGGA
CACCATGGGGGTGATCCGCAAAAAGACGGCCGTCCGCGGTGGTGAGGGTGGAGTGAAGTACGTATGCGATGTTTGCAGTG
CGGATATCACATCGACCGTGAGTTCCATCCAATCCCTCATATTCTTGGTTGCCAGCTGCATTTTATTGCGCTACCGGAGC
TCTCTGACTTGGACACGGGGTCGCGCACAGGCTGTCTATCCGTGGTGCGGAAGTCTATGACAGGAGCCGGAAGCTTAAGC
AAACTCCCTAGCAGATACACGTGCATTGAAGGCGAAGACTGACTGTGGCCTGTTGATAGGTCCGCATACGTTGCGCCCAT
CCATCTTGTAACGAATACGATCTCTGCGTGCTCTGCTTTTCGAACGGATCGTCCAGCAATGCGCACCAACCGGCGACACA
TCCGTACCGGGTGATCGAGCAGAACTCGTTTCCTATATTCGACAAGGAATGGGGTGCTGACGAGGAGCTTCTGCTAATCG
AGGGTGCCGAGATTTACGGGCTCGGCTCGTGGGCAGATATTGCAGACCACATTGGAGGCTACCGGCACAAGGACGAAGTG
CGAGACCACTATCTTCAGGCATACGTCGAGTCGTCAAAATTTCCGCTTCCGGAACGATGCAGTCCGCAGGACATGCAACT
GGCCAATGAAGTGCCTAGGGAAGAATTTCAAGCCAGGAAGAAGCGGCGGATTGAAGAGAGACGGGAAGCAGCTAAGAACA
CACCAGCTCTGCAACCAAAGACGAAGCCAACGGCGTCAGTGCCATCATGCCACGAGATACAAGGGTACATGCCGGGACGG
CTGGAGTTTGAGACGGAATACGCCAACGAAGCGGAAGAGGCCGTGCAGTTGATGCAATTCGACCCCGGCGACGGCATTAA
TTCAAGGACGGGCGAGCTGGAACCGGAAATGGACCTGAAGCTGACAGTCATGAGGATCTATAATTGCCGGCTTACGCAGC
GGGTGGAGCGCAAGAAGGTTATCTTCGAGCACAACTTGCTGGACTATCGAGAGAACAACAAGCTGGAGAAAAAGCGGACG
AAGGATGAGCGCGAGCTGGTAAACAAGGCGAAGCCGTTTGCGCGAATGATGAATCATGACGACTTCAAAAAGTTCAGCGA
GGGTCTCACGTACGAGCTGTTTCTGCGACAGGCCATTTCGCAGTTGCAAGAGTGGCGCAGTGTGCGGATCGGCGATCTCG
AGAGCGGGCTCAAGTACGAGCTCGAGAAGACGCAGCGGCTGCAGAAGGCGATACCGCTGGGCAGCATGGACCGCGAGCGG
CTGGCGACAGCGCAGCGGAATAAGCAGCCGCCAGCACCAGAGCCGCCAAGCGGAGCGGCGCGACTGCTGGCGCCCGATCT
CAAGGGCCTGGGTGCGGACCTCGAAGGCGGCGCGGCGGCGATGGCGGCAGCAGCTGTCAACGACGATGCCGTGGCCAACG
GAGACGTCAAGCCAGTAATCAATGGAAATGGATACGCTGATGCGGCCTCTGTTACTTCCAACGGCATCGGGACGCCGAAC
GGCTTCGGCAACGGCACGGGATCGGGCAGTCTTGCCAACGGATCCAGCTTCATTAATGGCAGCGGCATTGGCGTCAAGAA
GGAGAAGATCGTGCCACAACCGATCGCGGGCGTGCAGCCGTTGACGCTGACGCAGGACAATGCGGCAGACTTGCAGCTGC
TGACACCAGAAGAGGTGGAGCTGTGCCAGGTGACGCGGATTCAGCCCAAGCCGTACCTGATGATTAAGGAGCAGATCCTT
AAGGAGGCGCTCAAGGGCAACGGCATGTTGCGTAAGAAGCAAGCCAAAGAGATTTGCAAGCTGGACTCCCAAAAGGGGTC
ACGCATCTTTGAATTCTTTGTCAATTCTGGATGGATTGGGAAGGCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62