GenePrediction:GLEAN_3659 Details

Name: GLEAN_3659
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:115142..117538 (+ strand)
Length: 2397
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:115142..115347 (+ strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_113:115702..117538 (+ strand)
Length: 1837
>GLEAN_3659 class=GenePrediction position=GCSC_113:115142..117538 (+ strand)
ATGAGCACCGAATTCACTTTCAAAGTGGTGATGCTGCGGGGCCGAGAAAGAAGGACCATCGGCTTCAGCCAGAGCGAGAT
TGCCGTGCTCTACGACGTCCGCTACGACAGCCGACCGGTCTTTTCCCGGCACATGCGTCCATTCCGCCTCGACGACTGCG
ACGCCCGCTTCACGGCCGTGGCCGGGGTCAAACAAAACACACCGGCGTACTGATGATGCTCAGGGCGGCACAAAAAACAA
TAGAAACTCCGATACGGGGAATCGAACCCCGAGCTAGTCGGTGAGAGCGACTGATGTTAGCCATTACACCATATCGGAAT
AGATGCTTAGTCATTACGGATGGGAACCCGGAAGTAGTTAATGAACTGCACAAATCACCGTCTCAACACGGTGCTTCGGA
CTGTGTCAAACAGTAGACTAATAACGACTCGTATTCACATGCTGAGTAAAGGCAGCCGCGGAAGGACCGACCGAGGAGCC
AGGCAGAAACGGCGAAGTTTCGTGCACTTGTGCAACGTCCTGAGCATTAAGCATCACATCCCCTTGCATTTTTGCCCTAG
CCTCATGTCCTCTCGCTCGCCTCCCATGGCTCAGAACGCAACCGAATACGCGCTCGTGCTTCCGTCATGGGACCAGCTCA
ACTTTTCGCGCAACTGCACGGCCTTTGGCCAGTGGCTGTACTCTTTCATCACGGCCAATTCGTGGGACAAGCAGGCAACG
TTTGGTGGCAGCGTCACGCTGTCACTCGAGATGTTCGATGCCGCTGTACCGCCGGACTGGTCCTATCTGCAAAACGCCAG
CGACGCCCAGACGGCCACGCCCGACGGTCGTGCCGCCGCTGCCACTATTTACTATGGCCGCGTGCTGCAATGGTTCAGCG
CCAACCTATTCTGGTCCTACAACAGTACCACGGCCTCCTGGGACAGCAGCCCCAGCTTCAGCGAGAATGTTATCTGGCAG
CCGGCTGTAGCCTGTCCCGAGCATTTCTGCAAGGCTGTCGCCTTCACCGGCAACTCTGACCTTTCCGGCATCGGTGTCCT
CATCTCCTACCTGACCGAGGCCACCCTCGTCACGGCCTACCTGATCTGCTTCACGCTCTCGCGAGCCCATCGCGCTACCC
GGCCACATCGCCGTCGCCACAGGCACAGTCGCAGGCACAGTCACAGGCACAAGCGTTCAGTGGCCCGTGCCGCTGCCCGC
CGCCTCTTTGACGCCGTGCGCGGCAGCCTGACCGGCTTTCTTACCAACGCCATGCTCTTTTCCTCGGCCATCCTCACAGC
CGCCGTTGTCATGGCTGCCAAGCAGGCCGGCGACAACCGCAGCCGCCAGATCGGCTCCCAGACCATCCCCACTGGCAGCG
CCCTCTACAATCCCGTGCTTGCCCTCTTAGTCGGCCTCTTTTCCGTCTTCCCCGTCGCCATCCTGAACCTTTTGCTGCCA
GAGCACGACGGCGATGACGACCACGAGACCAGCAGACCCAACACAAAGACGGACTTCCTGCCACTGCTCCATCGCCTTCG
ACACCAAGCCGCCACCGCTTCCTTCACCCACACCCTGGCCTCGTTCTCCCGCAGCATCGCCGGTCATCCCTCTGGGAGTC
GCACTAGCCTCCGCCGCGTCGTGCTCGGCATCCTCTGGGGCCTCGCCATCGCCATGGTCATCGTCTCCCCCCATAGCGAA
CTCGACTATACCTACCGTGGTGTCTCTTCACCCGCCGACGCCGACGATGACAACACCTTTTCCGACGTGCTCTACGTCTG
CGACGCCCGCGGCGGCCTCACCTACTGGCACATCCTCGATGCCCTACCCTTCCTTGTTGTCGGCGTGCCCCTGCTGTGGC
TCGGGCTGACCTCCGTCCTGTACAGCCGGGCCCGTCAGTCGCCGCTGCACTCACCTTCCGCAGCATCTCCCCTGCCACCC
CTCTGGACCTTCGCCTCCGCCTGGCTCTGCTGCGTGATCATGTGGGTCATCCTCATCTCCTTTGTCAATCTCCGTGGCGT
CATCGTCAAGACCGCTGGCAGCATGGACACAGATGACGAGTGGGCCTTTGGCCAGGTCCTCGCTATCGCCACCTGGGCTC
CCGTTGTTGCTGATGTCATCTATCTCTTCGTCTTCGGCCTCGAGGCTGGCCTCGCCGGCACCCTTCCCAATGACTACACC
GTCCGTCGCATCGCCACTACCGCCGTCAGCCAGCACGTCCTTTCAGCCCCCCAATCCCTATACAGGAAACAACAGCAGCT
AGATGTGTCTTTGGCATCGGCGTCATCTTCACCGTACAACCAGTCAGGCGCCAAAATTGTCTCTGCACAACAGACCTCTG
CAGAGAGAGCTATTTCATCGACGTCCGCCAGCCCACAGAGCCAGTCTGCACAAAAGGATCCTGAAAAGGGCCGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62