GenePrediction:GLEAN_3660 Details

Name: GLEAN_3660
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:117830..118356 (+ strand)
Length: 527
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:117830..117985 (+ strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_113:118046..118195 (+ strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_113:118264..118356 (+ strand)
Length: 93
>GLEAN_3660 class=GenePrediction position=GCSC_113:117830..118356 (+ strand)
ATGCAGCGCCAGACTATCCAGACCAAAAACGCTCCAGCAACGGGCACGCATTTGTCACAAGCGACCATCCATAATGGTGT
CGTCTACTGCTCCGGTGCCCTGCCTATTGACCCTGTCACCAACGAGCTGGTTGGGGGCACCATTGGTGACCGGACGGTGA
GCTGTCTTTACTTCTCTATGGTTTTCACTCACAAGTCCCGCTGACTTTCTCCTCAGATCCGCTGCCTCAAGAACCTTGAG
GCTATTCTAATCGCAGCCGGCTCCAGCCTGGACAAGGTCCTGAAGGTCAACATCTTTGTCACCAATATCAAGGATGTTCC
CGCAGTGAATGAGGCCTACACCTCACTATTCTCGGAACCGCGACCGGTATGCCACCCTGCTGTCGACACTAGCCGTGCAC
ACACATGCCGACATACTGACACCACCATCACCAGGCCCGTGCATGCGTTGAGGTCAGCGGCCTGGCCAAGGGCACTGACG
TGGAGATCGAGTGCATTGGATTCATTGGAGAGATTAGCAAGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62