GenePrediction:GLEAN_3664 Details

Name: GLEAN_3664
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:140251..142086 (+ strand)
Length: 1836
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:140251..140385 (+ strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_113:140464..140978 (+ strand)
Length: 515
Type: CDS
Source: GLEAN
Position: GCSC_113:141047..141400 (+ strand)
Length: 354
Type: CDS
Source: GLEAN
Position: GCSC_113:141417..142086 (+ strand)
Length: 670
>GLEAN_3664 class=GenePrediction position=GCSC_113:140251..142086 (+ strand)
ATGGCACCAGTAATGATTTCTCTCAGAAATGTTGCTTCAACTGGTGGGCTGCTTATTGCCCTGGTGGCGTTGTGGTACCT
GTATCGTGGATACTGCGTGCGAAGACGCTTCCAGAGATTGCAGAAGCAGGGAGTTGTAAGTGCAGACAGGTCCGATCTCA
CGAGATGGGTCTAACGCATGTGATGTTTTTTTCATTGGCAGCCCATGATACAGCATCACCCAATTTTCGGGCATCTCATC
GCTGTCGGCAAGCTCATGGCAGACATACCCAAGGATGCCCACGGCGATTATCTTATGGTTCTCGTCCAAGACAACTGGCA
ATACCTATTCCCTAGCTGCAAGCGCTGTCCACCGGCGGCCTACCTCGATCTCTGGCCCTTTTCGCCGCCTATGATTCTCA
GCCTGCACCCGGACGTGTCGGCACAATTCACGCAGGACTTTAGCCTTGACAAGGCGCACAGTACGGCCGCATTTCTGTAC
CCCTTGACGGCCAACCTGGACGTGTCATCAAGTAATGGTTCGCAGTGGAAGCTGCGACGGCGGCGCATATCTCCAGGGTT
CAGCATGCAGAATATCACGTTGCGTGTGCCAGATCTGCTCGAGGAGGTGGAGGTTTTTGTGGACGTACTGCGACGGGCAG
TGGGCAAGGACGGTGGCTGGGGGCCCGTATTCCCTCTTGAAAAGAAGGCGACGCTCCTGACTCTCGACATTATCGGCCGC
TTCACCTTGTGAGTAACGAGATTTGGGATTTGGACTACGACGAAAGGCAGAAAGTAGAAGTGACCCGGTCGGCCAGGGAT
GTGCGATTGCACGAGCAGACGTCTCCTCTGACGCCGTTCTCTGCCGGGATGCTAGATGTTATTCCGCGGCTGTCTTTCCA
CATGCACATCGGCAACGTCCTAACGGCACTGAATCCATGGCAGCAGTTGAGGGTGTGGTGGGACAACCGCATGATGGACA
ACTACCTGCTGCCGATGCTGAAAGCTCGTATTGCTGCGTTAGGGAATGACTCCGGGCCGAGTGACGAGAAGCTGAGCAAA
AACCACAAGACGCGCACCGTGATCGACATCCTGGTGCGTGCAATGGCCGACGACCGGGAGGACGAGAGCATGTTTCTGGC
TTATGCATTGGCCGAGACGAAGCACACAATGTTTGCCGGTCACGAGACGACGGGCCTTCAGCCTGGCGTGGATCTTCCAC
ATTCTGGCGCTCCACCGAGATGTGCTGGACAAGGTCCGGGCAGAGCACGAGTCAGTGCTAGGACCGGACCCTGCGGCAAG
CCTTCGTGCGTCTCCACAACTGCTCGGTCAACTCGTGTACACCGGCGCGGTCATCAAGGAGATGATGCGCGTGCACACCA
ATGTTGGCACGATGCGCGAGGGCGCACCGGGCTTCCAGCTGTACGGCCCAGCCAGCTCAGGCTTCGAGGGCGTCGCATTC
CCTACCGAAGGCTGTGTCGTCTGGGACGGCAATTTTGCCATCCACCGCAACGCAGCGTTGTGGCCGCGGCCCACGGAGTT
TGTGCCAGAGCGGTGGCTGACAACAGACCGGTCGGACCCGTTGCACCCGCGGCACAATGCATACAGGCCGTTTGAGCAAG
GGCCGCGCAACTGTGTGGGACAGCATCTGGTGGTGACGGAAATGAAGATGGTGGTGGCGTTGGTGGTGTGGGAGCTAGAG
CTGGAGCCGGCGTGGGACGAAAGGGACGCGCAGGGAAACACACACAAGAAAGAGACAGTCTGGGGCGAGAGGCTGTATCA
AGTCAGCCGAAACGGGCCCCCGCATGTGAAGGACGGGATGCCGGTGCACGTTCGACTCCGACAGGCAGCATTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62