GenePrediction:GLEAN_3665 Details

Name: GLEAN_3665
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:142606..144342 (+ strand)
Length: 1737
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:142606..142785 (+ strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_113:142843..144141 (+ strand)
Length: 1299
Type: CDS
Source: GLEAN
Position: GCSC_113:144214..144342 (+ strand)
Length: 129
>GLEAN_3665 class=GenePrediction position=GCSC_113:142606..144342 (+ strand)
ATGGCAGAACTCGAGGACGGCAAAAGCAGTAAGAAGGCCGCTGAGGCAGACTCGATGCCAGCCGGAGCACTGGACAGCAG
AGACGATGATTTAGATTCTGGCGAGAATGACATAGCTATCATTCCCAAGGGCACAATCGACCCGGTGTACGAAGCCAAGG
CGCGGGTGCTGAACCGTGCAGTAAGCAATTGATTTCCACTTCTCTCCCGGGCCTTCGGCGTTGACTGACACGCGCAGATC
CAGAACATCGGCATGGGAAGGTATCAGTGGCAGCTGTTCGCGGTGGTGGGCTTTGGCTGGGCGAGCGACAACTTGTGGCC
GATTGTCACGTCGCTGATTTTTACGGCAATCAAAAACGAGTTCCACCCGTCGCGGGCACCACTGCTCACGCTCGCGCAGA
ACATCGGCCTGCTCGCCGGGGCAGTCTTCTGGGGCTTCGGCTGCGACGCGTTTGGGCGACGATGGGCGTTCAACGCAACA
CTGGGCCTGACAGCGGTGTGGGGGATGATCGCAGCGTGCTCGCCCAGCTTTGCGGCCATCGGGGTGTTTGACGCGCTGTG
GTCGTTTGGCGTGGGCGGGAACCTGCCGGTGGACTCGGCCATTTTCCTCGAGTTCTTGCCGGCCTCACACCAGTACCTGC
TGCCGGTGCTGTCGGTGGACTGGGCACTGGCCCAAGTGGTGGCGACTCTGATTGCGTGGCCGCTGCTGGGCAACCTGACG
TGCCAGGAGAACGAGACGGTGTGCCGACGCAGCGACAACATGGGCTGGCGGTACTTTGTGATCACGATGGGTGGTTTGAC
GCTGGTCATGTTCCTGGTGCGCTTTCTGTTGTTCTCGATCCACGAATCGCCCAAATACCTGATGGGCCGCGGGCTGGACG
AGGAGGCGGTGCGGATTGTGCATGAGGTGGCACGGCGTAACGGCACGACGACGGGCCTAACACTGGAGCATCTGCAGGCG
TGCGAGCCGGAAGGATACGTGCGACCGACGGACTCGTCAGCAGCAGCGCTGGCATTGGCGGCACTGCGGCGCAAGATGGC
CGACATGGATCTGGGCCGAGTACGGGCGCTGTTTGCAACGCGGCAGCTGGGGCTCTCGACGGGTCTCATCATGGCTGTAT
GGGCGCTGATCGGGCTGGCATACCCGCCGTACAACGCCTTCCTGCCGTACATCCAGGCGACGCGGGGTGCCGACTTTGGT
GACGGGTCGACGTACCTAACATACCGCAACTCGCTCGTGGTAGCTGTGATGGGCGTTCCCGGGGCGCTGCTGGGTGCCTG
GCTGGTCGAGCTGCCGCGTTTTGGCCGCAAGGGCACGCTGGCCCTGTCGACGGTCGTCACCGGCGTGTTCCTGTACGGAT
CGACGACGGCCCTGACATCGAACGCGCTGTTAGGCTGGAACTGCGCCTTCAGCCTGGCCAGCAGCACCATGTACGCCGTG
CTGTACAGCTTCACACCCGAGCTCTTTCCTACGCCACAGCGCGGGACCGGAAACGCGCTGGCGGCGACGTGCAACCGTGT
GTTTGGCATCATGGCGGTGGGTAGCAGATTTCTTTCTTCTTTTTTATCTTTCTTCTTCATACTGGCTGTCCGGTTGCTGA
CCATGCAGCCCATCATCGCCATGTTTGCCAACCTGCAGACATCGGCACCAGTCTACACGAGCGGGGCTCTCTTCATTGCT
GCCGGTCTGCTTGTACTGGTGATGCCGTTCGAGTCGCGGGGCAAGTCGGCACTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62