GenePrediction:GLEAN_3666 Details

Name: GLEAN_3666
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:146998..148294 (+ strand)
Length: 1297
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:146998..147535 (+ strand)
Length: 538
Type: CDS
Source: GLEAN
Position: GCSC_113:147927..148294 (+ strand)
Length: 368
>GLEAN_3666 class=GenePrediction position=GCSC_113:146998..148294 (+ strand)
ATGGATAAAAGACTGTCTCCGGCCAGAGCGAAGAAAGTAATCGACTTGCTCGGGGCTCGCCTTCGCAAGGAGATTCGCAG
CATATACGGAAAGGTTGATGATACGATGGCCCAGTACATGATCAACGAGCTCCACAGCCAGATGATAGTTACAGTGCCCC
ACAACCGACTGTACATGCCATGGACGGCGAGCGACGAAGGATTTTTGGCGATGTATAAAAGTGTCGGGAGACCGGCCAAA
GAGAAGGGCGACAAGACCCGGAATGCGGACGATGCGGACAATGTGGACAATGTGGAAATCAAGCGGGAAGACGCTCCGGG
TGAAATGGGCGAAACTATCGCCTTTGCTGCTAATATGAGAAAGCGAAAGCAGTTGGCAACTCCAATGATGGAGCTAGAGG
CACCGCGAAAGAGAAGACGGCCAAGAAGGAGTCTGGAGTCTGGACTGTTGGACCAGCCGGAATGGATAGCAGAACTGGCA
GTGGAGCAATTTCAGCACCGACTCAGTCAGACGGACACAGATGTGACTATCACAGAAAGTGACATCAAGCTCTTCTTCTC
GGCTGCTCTCCATTGGATATTCCACGGGTCAACCCGAGGACTGCTCCCAGACATCCTCCGAGAGAGCTTCGGGCACGGAG
GCAGGTTCAACTTGAATAACATAGCGTGAATAGGTTGTCGGAAAAGCTGCGCGTGGAAGAGCAAGACACTGAGATGGCCG
AATTTACCCAGAAATGAGGCGAGATGGCCCTGCATGAAGGGACACAGAGAGACAGTGTGCGCCTGCTCATGTTCTCACGC
AAGGTGGAAGTGGTGCATCGCTTTGACGGCCTGATGCGACCGGAGAGGCGGCAGTGGACGATCGACCTGCTAAGACGCCA
CGGCTTACGTTGTCGCCAAGGCCTGAAAATGCGTAACTGTGTCACACAGTTCCTCAGCACGGAGCTCGGCCTATCGAGCA
GGAAGGCGTCTTGGACTCTATCCGAATTTGGCGGTCGGTGGCCGAAATTTCCGAGTGCTTCGGCCAGGGCGCCCTGCTCT
TTCTCAATGTCTTACCGGAAAGGACGGCAACTCGACTGTACTCGTCGGGTCATCGAGTATCCTGCGACAGGCGCCGGTTA
CCACCATTACTCGCCGCGGCGCGCGAACAGTATCCAGGCATCCAGCACATCTGTGACCTGGCTCGGAAGAATGTGGTGGA
GCCGGTCCTCCAGCAGCACAGTCTTCCTGTAACGCCGGCACCAGAGTTGGGCCTTTTGCCGCTCGAAGAGGCGCTGCGGC
GAATTGGGCAGTCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62