GenePrediction:GLEAN_3667 Details

Name: GLEAN_3667
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:149310..150949 (+ strand)
Length: 1640
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:149310..149549 (+ strand)
Length: 240
Type: CDS
Source: GLEAN
Position: GCSC_113:149612..150949 (+ strand)
Length: 1338
>GLEAN_3667 class=GenePrediction position=GCSC_113:149310..150949 (+ strand)
ATGACAGACAACCAAGCCGCCGTCTCTGGCGCGGCCAATGACAAGGAGGCCCAGATCGTCACCACGGCCATGGCGAGCTC
TGCAGACAATGACAGCGCGTCGCTGCACAGTGCCGGCGGCCGCAGTCTCCGGGTGCCCATGACGATGAAGCTGCTGTCTG
TCGTGCTCGTGTCCCTGATCGGCTTCGGCTCGCACTGGAGCTCGGGCGTGACAGGTGCCATGAAGAGCACGCTGAAAAAG
GTACGCTCCCGTCCTTCCTTCCTGTTGTCTTCGTCTCTTGTCGGCCTGCTCACGCTCGGCAGAAATTGCACATCAACAAC
GCCGAGTACGCGCTGCTCGATGCCAGCGAGGACTTTATCAAGTCGGCCCTCATCGTGGGCACCGGCCTGGTGACCGATCG
GATCGGTGGTGCCCACGCGCTGCTCTGGGGTAACTCCCTCTACAGCGTGGGGGCCATCCTGGTGGCAGCAGCCACGACGG
TGCGCAGCTACCGCTTCATGATCGGCGGCATCGTGGTGCAGGCCATTGGCGATGTGACCACGCAGGTGGCCCAGTACAAG
GTCTTCTCGTCCTGGTTCGCGCCCTCGGACGGTTTTGCTTCCACGCTCGGCTTTGAGCTTGGTCTCGGCAAGATCGGCTC
CTTTGTCGGCCAGGCCACGGCCAACGTGATCGCCCGTCGTCTCGGCGACTTCAGCTGGGTTTACTGGATGGCCGTGGTGA
TGAACGTGTTTACCAACATCGTCACCGTCGGCTTCTTCTATTTCACCCGCTGGTGTGGCCGCCGCTATGGCGACCTGGCT
GATCCGGCCACTGGCGAACGACTGACCGAGAACAACAAGTCGTTTGAGCTGAAAAAAGTTTGCGCCTTGCCGTGGCCCTT
CTGGGCCGTCATGGCCTTTTCCCTCTTCGAGACGTCGACGGCCATCGTCTTCTCCGGCAATGCCACCGAGCTGGCCGAGC
AGCGCTTCCACATCGACTCCGTCAAGGCCGGCTGGTATGCGGCCCTCAGCAAGTATACCGGCTTCTTTCTGGTTCCCGTG
CTCGGCTTCGTCATCGACCGCTTCGGCCAGCGCCTTACTATCATGCTCGTCTGTGGTGCTTTCATGTTCACCGCCATGGC
CCTCGTCGCCTGGGGCGAGACCGTCTCTGGCACCGCTGCCAGCTTCGGCGTCTATGCTGTTGCCTTGTCGCTCGGTCCGA
CTACCATCATCGACTCGACCCGCACTTCCATGTGGTATCCCGAGGTCTTTGGCTCGGCCTATGGCATCAAGATCGGCCTC
AACAACGCCATGAACATCATCATCCGCATCGTCACCGGCGTTATTCAGGACCAAGACAACGACAGCTACGACCGCGTCGT
CATCGTCTACGCCGTCCTCGCTGCTGCCTCCCTTGTCGTCGGCATCAGTCTCGTCATCCTGGGCCGTTTTAGCATCGACC
TCGGCCGTCTGCAGTGGAGTCGCATCAAGCGCATGGCTAAGGGCCACACCATTGGCGAGCGTCGTGAGCTCTTTGAGACA
GGCAAGAACGCCAGACGTCATCGCCTTTTCAGCCAGTCCTGCCTCGTGGCTGCCATCTCTCTGATTGTGGGCTCGTGGAT
CGCCTACTTCTGGGGCGTTGCAACAGGCAACAATGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62