GenePrediction:GLEAN_366 Details

Name: GLEAN_366
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1328360..1330847 (+ strand)
Length: 2488
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1328360..1328414 (+ strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_167:1328470..1328920 (+ strand)
Length: 451
Type: CDS
Source: GLEAN
Position: GCSC_167:1328993..1329116 (+ strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_167:1329204..1329795 (+ strand)
Length: 592
Type: CDS
Source: GLEAN
Position: GCSC_167:1329859..1330847 (+ strand)
Length: 989
>GLEAN_366 class=GenePrediction position=GCSC_167:1328360..1330847 (+ strand)
ATGGACCTCGAGCCAGATGAAGAAGCAGCTGCACTGGTGGGCGATCTGGTCCAGGGTGAGTGCTCTTATTTGCGTCACAT
GCGGCTCCGCCGACCGACTGACCTGAACAGCCGCCCGCGTGCCGGCCAAACGCCGTCCGTTTGCGGTCAAGCCCACGGTT
GAGCGGCTCGCCTCGCTGGCGTTTGAACACGGGCTGCCGGCCGACGCGCTCCGCAACCTCGTCGACGTCGTCACGACTCC
CGGCCACCTGGACCAGGCCAGTCTCGGCGCTCTCGTGCGAAACCTGTACCCGGCTGTTTCGGCCGTGCCGGACGACGTAG
TGCTTGCCGTCGTCGGCTGCCTCGGCCAGGGCCAGCTCAAGCCGTCGCTGGCCGTCCAGGCGCTGCTGTTGCGATGGCTC
GTGCTGGTCTATCATGTGCTGGGCAGCCCGGCCGTGCTGTCACGCGCGTACGGCGTGCTGTTCAACCTGCTTGACACCGT
CGGCATCCGGCCACAGCTATGCCACGTCCTGGCCCTGATCACCCGACGGAGACATGTGCGGCCCTTTCGGATCCAGGCCA
TGTGAGTCGGGAGAGAATGCCTGCCTTTGTCGAGGCGTCGTCGTCAAATACTGACCGTGCGTCCTTTATGCAGACTCAAC
CTATCGAGACAGGCTGGACACGATCCGAATCTGATCGGCCTGCTGCGCGTGTTCAAAAATTACTACCCGGAAGTGATCGT
CGGCGAGGCCACGCGGGGGAGAGCGTCCCCATTTAAGGTAGGTCTGTCCGGGCGAGCCAAGGGTCCATGTCCAATCGCTA
GGATGAGCGCCAGCTGACCCCGTACTGCATCGTCCTCTCTTCAGCATCCAGACCCGCCATGGCGTGCGAGGCTGGACGAG
ATCCAGCTCGCCCGCAGACAAAATCTCCTACAGGGTGGCAGCAGCGGTGCCGCGACGCCCGAGATGCAAACCGGGTTTCG
CGTGCGACAGGATCATCAGCTCGGACGCCGGACGGCCGGCGGTGGTGCCGCGCTTTCGGGAATCCCAGCTGTGCACACTT
TGCATGCACAGGAAGAGTCGGTCACACTTGAGGAAATTGACAGCGCCGAGGGCCTCGTGCAGAACCTTGAGAAAATTGAG
CTGCCGAGCCAACTCGTCGCCGTGCTGGCGGATCCGTTGCTACAGAAGCTGCTGCTGCTGCGGCCGGCAGCTGAGGCGAC
TGCGCGAGCTGACAACTGGCTGGCGGCTTGTGTGGCTAGTGTGGCCAGCGGTGACAGCAGTCCTGACGAGCTGATGGACC
TGATGGAGGCGGTGAACGACTACGTCACCAGCACGCAGACATTTCCGCCCGTGCTGCATCGCTTCTTCGGCCAGCTTCTG
TCGACGTGGGACCGCCAGACCCAGAAAGAGCTCATCTTGCAGACCCTCTCGTTTGTGCCGGTCCAGGGCTTTGAAGGTGA
GCTGACAGAGAGAGAGGATGAGAGGAAGAGAGTTGTCTAGCTGACATGTATTGCTCCAGAGACATATGTGTCGACGTTTG
CGGTTCTGGAAAAAGCGCTTCTCGACAGTTCAGCGACTTCACATCTTGATCTGCTGGCCTTTTACACCAAGGTTCTGCAC
AACTGGAGAGTGGCACTGACGGCCACCAAGGGTGAAGCGGCGTCCTCCCAGAACAGCGATGCGGCAGCGCTACCGCGATT
CATCGGCCATGTGGCCAAGCTGGTGCTGGTCGTGTTGCAGACGCCACCGGCTGTGTCCTCATCGTCTTCGGTGCCGACGG
GAGCCGCGCTGGCGGTGCTGGACTTTTACGAAGAGGTGACGGGCACGCTGGGAATGGGCCGCGACGACGTGCTGGAGCAA
GTGCAGGCGGTGGTGCCGCCGCCGACAATGGTGTACACGATGCACTTCAGCCAGTCGGCTGCGGTAGCATCGCGGCTGTA
CGCGGTTCTGGCAGCGTACAAGCGAGCGCTGGAGGCAGCGATGGCGCGACGGCCGGGTCGACAGCTGGCGGCTGAAGAGC
GGGCGCGCGTCAATCTGTTCAACGGTTTCCTCATGGACGTCTGCAATTGTCTGTGGCGTCTGCGGGCGTTTTCCGGGTCC
GACACCAATGCCCAGGGCTGCCGCGTGCCGGCCGTGCTAGTGCCGAAACTAGCACACTATATGCAGGTCGTGGACCGCGA
TCTGGCCCTGACGGCCGCCTTTAGCCTGTCGCAGTCGCCGGTGATGTGTCTGCAGGCCATCCGCTATCTCCGGGCGCTGG
AAGACGCGGCGATCGGGCAGGACGACAGCGACAGCGGCAGCGCGACGACAGTGACAGTGCGTCGACGCCATGCCGGGCCG
GTCACGCAGGCGGCCCTGGTGCAGCTGGCCCGTACTGGCGGCATCAACGTGTCGTGGGCGGCATACCGATCGGGGCTGCT
GGACCACCTCGAAACACGCGGTTTTGGCGGCGTTTCGGCTCTGATGCACAACACAATGAAGAACCTAATGAACGCCCAGA
CGGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62