GenePrediction:GLEAN_3670 Details

Name: GLEAN_3670
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:168922..171663 (+ strand)
Length: 2742
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:168922..168990 (+ strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_113:169044..169171 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_113:169227..169268 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_113:169322..169388 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_113:169444..169484 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_113:169537..169626 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_113:169680..169928 (+ strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_113:171540..171663 (+ strand)
Length: 124
>GLEAN_3670 class=GenePrediction position=GCSC_113:168922..171663 (+ strand)
ATGGCAATGCCTACACCCAAGCCCGGCCTACCTAACGGCGAGAACCAGCCTCTTCAGGCTGCTGTTTTAGTAAGCCGCCC
TTTCCTGCTTCGTGCTTGTCGACAATCTAACCGCTCGCCCAGGATGATGCTAACTCCTCACTCGGAAACGATGCCGCCAG
CTCCACGGCGTCTATCACGTCGAGCATCTTGCGCTACCGGACATTGAACGGCCGGACCTACCACAGTGATCGGGGAGGCA
GCCAGTACTGGTGTGTTGGAGTGTTCCGTTGGACCTGCTAAGCAAAGCGCGCTAACAATTGTAAGGGGTGCAAATGACGA
TGCCCAGAACACCATGCTAGACATCCAGTAGGTCAGCCAAACGGAAATTCTGCTGGTTTGCCACGCTAACTGTTTGCTAG
ACATCATGTATTCACACTGGTCTTGGATGGCAAGCTCTATCTGGCGCCTTTGCCGGAGGAAATTAATGTAAAGCTGCAAT
ATTGTGTATACCCAGTACTTTCGAAACTAACACGTGCTCTAGAAAGTTTTGGACATTGGAACTGGAACAGGTCTCTGGGT
CCTGTAAGTATCTTGCTCCTTCTGCAATAGGAAAACAGCAACTAATATGGCCTAGTGACTTTGCAGACCAGCACCCCCAG
GCCACCATAATTGGCACCGATCTCTCTCCAATTCAGCCGACATGGGTTCCGCCCAACGCACGCTTGTATGGCCCTCTTCG
GTTCCTTCGTCTATACTTCATAGCTGACAAGGTCGTAGCGAGATCGACGATCTCGCAGAGCCATGGACGTTCGATGAAGC
ATCAGTAGACTACGTGCATATCCGTTGGCTTATTGGCAGCGTAAGGGACTGGCCGGCCTTGTTTAAAGAGGCCTACCGGG
TCCTGAAGCCGGGAGGTTGGATCGAGTCGTTTGAGTGCAACGGCCTGTTCGAGTCTGATGACGACTCTATCCCCGAAGAT
TCTGCTACCTCCCAGTGGAACGATATCTTCGGAGCTGGTGCCAAGACGTTAGGTTCCTCTTTTACCGTTGTCCAAGACGG
TGTCCTACAAAGAAGCCTGGAAGAGGCTGGATTTCCAAGGATTAAGGAATCTCCGTTTAAGGTCTCGGTGATTTTTTTCC
ATTCTCCTCCAGCTCTCATTCTAATAGCTGGCAGATTCCATTTTCCGAATGGCCTCAGGACCCGAAAATGAAAGAAAAAT
TGGCCTGTTCGCCCGGCACGTATTTGAGAACGACATCGAGGGCAGTGTTGGCCTGCTTGCCACCATGCTCGGCTGGTCAA
AGGACGAGATATCCGTGTTTGGGGCCCGTCTTTGTCGCGATATGCGCTGCATGGATGTGCATGCGTTTTACTGGTGCAAC
GTGATATGGGCCCAGAAGCCTTTCCATGCCTAGAACTTCAATAGTTGACATGTTTGGCTGCTACGTACTACTATCACCGG
CTGCTCGATTGCTGTTCTATTGATGACACACCACACCTTTCTTGAACATGTGTGGCTGTCCCCCTACTCGTGAGCCTGCA
GCGCAGCATTGTTGGTCACATTCGGAGAAGCGATGTGACACTTATGTGAATACGGACTGAAGGTAACATATTAGCCATAC
ATATCATAAATGATATGTATTCAAGAGTTTTTTATTCTCTGAATAGTTCCACCCTACCAAAAATCTTACTCCTCTTTGTA
CTCCGTAAAAACCTCCCGCTTCCCTGATCTCCCGCTTCTCTAATTAATCTGGTTCCTCTCTACGCTCTACGTCGTGCGCA
CTGTATGTCGGGATCTTTTTGTTGTATGACAATATGGCAGATCACGCGGCAACCTTCATGGCTGCAGAATCGCCTTTGCC
TTCGCCTCTGCTACAGTCCGACATCATTGCTGCTGATAACCATAGCGATGATGTGAGCCATCTACATGTCTCAGTCATGT
GCTTAGCTGACGTTGACTGAATGACAGGAAGGATTTGACGACAGACACTCTGCAATAGCAAGCGAAGCGTAAGCAGCCAA
AATCCCCACATTACAGAATGAATAGGAATCATCGCTAACTCATGGCCTGTCTTTCCTGTATAAAATAGGACCTCCACTGC
CTCCATAGCCAGTAGCATTCTCAAGTACCGAACCATCCAGGGACGAACTTTTCATAGTGAAAAGTACTCGCCGTACTTCA
CTCCCAACGATTCAAAGCAGCAAGATTCGGTCGATATCAAGTAAATCGCAGTAGAAGTACGCTGAAAAACTACACGTTGA
CTGGTCGTACATTTCTTTATTTGTACAAATTGATCACACAACTCTCTGACAGGCGAAAACTGCCCGTATCACTAGTCATC
ACTACCTCACCCTGCTGCTTGAAGGAAAGCTGCTTCTAGCACCGATCCCCAACGATGTACAAGTTGGTTTTACTTTCTTG
CACTCTTACCTACAGACAAATTAGACTGTGCTCTAACAACTAAATTACTAGAGAAAGTCATCGACATTGGGACAGGCACT
GATCAGTACTTTCGTACTTGCTGCTTTGAAAAAAAGCACATGTTAATTCGGCTTTAATAGGTATTTGGGCTATGTATGTC
TTTGCTTGTCTCTGCATCACGGAAATTGACCAGAAGTTTTAACCGTTTTATATTATAGCGACTTTGCAGATCAGTATCCC
AATGCCGAGGTTATCGGTACAGATATTTCGCCCATTCAGCCTGCATGGGTGCCGCCAAATCTCAAGTTTGAAATTGACGA
CGCCACAATACCATGGGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62