GenePrediction:GLEAN_3671 Details

Name: GLEAN_3671
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:173428..176411 (+ strand)
Length: 2984
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:173428..173942 (+ strand)
Length: 515
Type: CDS
Source: GLEAN
Position: GCSC_113:174109..176264 (+ strand)
Length: 2156
Type: CDS
Source: GLEAN
Position: GCSC_113:176329..176411 (+ strand)
Length: 83
>GLEAN_3671 class=GenePrediction position=GCSC_113:173428..176411 (+ strand)
ATGGAGCCACACCTCGCTGGATTCCCTCGCTGTTCTGCGCTGCTAGCTGAGCTGCGCCTCCTGCGCGTATCCTCGGTTTG
TTGCCCTGCCCAGACTGCGCCATGTTCTCCTACGAGCACCGGCGAGTGCCGGAAGCCGGCAGCACCACTGGGACTGGCGA
CTGCGCTGGAGCGTCCTCGCGGACACGGCTACAACGGCGCCGGTCATCTTTCCGCCCCTGCACACATGCCGAGAGTCCTG
CCTTCTGTGGCTTCTGCGGTACTCCCTGTCACCTCGATATCTGGACCTAAAGACGTGGGGATGGCCGTTGGTTACAGAGA
AGAGAAGGATATTATAAAGACAGGGATTCTGACAGTGATACATCGGTGCATGGTTCCTGCCAAGTCCAGCCAACTCCTTA
GCGCCGAGCGATCGATCGATGGTCGATCGCTTGACATCACGTGCCGCGCCGCACTCGGCATTATTGAGGGGCATTGCATC
ATTGCGCTAAAGAGCTTCGAACACTGGCGGGAAATGTTAGCAATTCGACGACGAAACATCGAGCCCATCTTGCCGACAAT
CGCCCTTTCCCGATGAGCGATTTGCAGACGGTCACGACGAACGAGACCAGATGCGAGAGAACCTTTCTTCTGCGCTTACA
TCCTGATCTTTGCGACTCTCTCCGCCCCGCCTCGAAGGCAGACACAGAACGGTCGATTCTTCTCGACTCATTCTCGACAA
CGCGCGACATGCGCATGGCTGCGTCCGCTCGCTGGCCATGATTGCACGTGGCATCCCGCGGGCGGCGACGCTCAGCGCGC
AACGGGTGCACTGCGGATGGTTGTGGGCGGCACCGTGGTCTCCGGGCTGTCCGGCCGCGGCGGCCATGCTTGATCGCCGG
CGGGGCGTCTTTTTGTCCGCGTCGGTCTTTTCGACGACGGCGAGCTGGCGTGCAGTTAACAAGGCAGCCGGATCTGGCAA
GGTGGCGGCAGCGTCAGAAGCAGCAGCGGCAGATGTGCGAATACAAAAGAAAATTGCGGTGCCGACAGACCCGCTCACGG
GCCCGGAAAAATCGGCCAAGGAGCAGCGGACGGCCGACTGGGCGATCATGAAGGAGATGTCGCGGTACCTGTGGCCGCGT
GGCGGGAGCGGTAGCATGGACACGAAGCTGCGGGTGTCGCTGGCTGTGTCACTGCTGGTGGGCGCCAAGGTGCTGAACGT
GCAGGTGCCGTTTTACTTTAAGAGCATCGTGGACGCGATGAATATTGACGTGGCTGCAGCCGGCGGCACAGCAGCCGCGG
TGGCCGGCAGCATGATCCTGGCGTATGGGGCGACACGCATCGGGGCGACCGTGCTGCAGGAGCTGCGCAACGCCGTGTTT
GCGTCGGTGGCCCAGAAAGCCATCCGCAACGTCGCCCGCAACGTGTTCGACCACCTGCTCCACCTCGACCTCGGCTTCCA
CTTGGCCAAGCAGACGGGCGGGCTCACGCGAGCGATCGACCGCGGCACCAAGGGTATCAGCTTTCTGCTCAGCAGCATGG
TCTTTCACATCCTGCCGACCGTGCTCGAGATCGGCATGGTCTGCGCCATCCTCACGTACCAGTACGGCGCACAGTTTGCG
GCCATCACGGTCGCCACCATGGCTGCCTACACCGGCTTCACCATCACCACGACGGCCTGGCGCACCAAGTTCCGCCGCCA
GGCCAACGCGGCCGACAATCGGGCATCCACGGTGGCGGTCGACTCGCTGATCAACTACGAATCGGTCAAGTACTACAACA
ATGAGCCGTTCGAGGTGGCCCGCTACGACGCCGCTCTCCGCCAGTACCAGAAGAGCTCAATCAAGGTAGCCACCTCGCTG
GCCTTCCTTAACAGCGGCCAGAACATTATCTTCTCGTCCGCTCTCACGGCCATGATGTACCTCGGCGCCGACGGCATTGC
CTCCGACAGCCTCACTGTCGGCGACCTCGTCATGATCAACCAGCTGGTCTTTCAGCTGTCCGTGCCGCTCAACTTCCTCG
GCAGCGTCTACCGCGAGCTGCGCCAGTCCCTGCTCGACATGGACACCCTCTTCAGCCTGCAGCGCGTCAACGTGGCCGTG
CGCGACGCTCCCAATGCCCAGCCACTGCTGCTGACTAATGGTGGTGCCATCCGTTTTGATCACGTGACCTTTGGCTACCA
CCCTGATCGACCCATAATGCGCGACCTCTGCCTCGCCATACCGGCCGGCAAGAAAGTCGCCATCGTCGGCCCCAGTGGCT
GCGGCAAGTCCACCCTGCTTCGCCTTCTCTTCCGCTTTTACGACGTCGACCAAGGCCGCATCCTGATTGACGACCAGGAC
CTCCGTCACGTCACCCTCGACTCGCTGCGTCGCAGCATCGGTGTCGTCCCCCAGGATACCGCCCTCTTCAACGATACCGT
CGAGCACAACATTGCGTACGGCCAGCTCGATGCCCCCCATGACCGCGTCGTTGCCGCCGCCCGCCGTGCTCAGGTCCACG
ACATCATCCAGTCCTGGAAGCACGGCTACCAGACAAAAGTCGGCGAGCGCGGCCTCATGATCAGCGGCGGCGAGAAGCAG
CGTCTGGCCGTGGCTCGCCTGCTGCTCAAAGACCCGCCCCTGCTCTTCTTCGACGAGGCCACCAGTGCTCTCGACACCCA
CACCGAGGCCGCCCTCATGGCCAACATTAACAGCATCTTGCGCGAAAAGTCCCGCACCAGCGTCTTTGTTGCCCATCGCC
TGCGCACCATCTACGATGCCGACCTCATCGTCGTCCTGAAAGAAGGCTCTGTCGCCGAAATGGGTACCCACCGTGAACTG
ATCGACCGCAATGGCGTCTATGCCGAGCTGTGGAGCGGTACGTTGTTTTCTCTGGCTGCTGTTGCTCTGGGCCTTTCTCT
TCTTATGCTAACGATCGTCAGCCCAGGAGACAAACTTTCAGGTCGAGGATGTCGAGGAGGGCGACGAGTCCATCACCGAC
GACGACGACACCCCTACCAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62