GenePrediction:GLEAN_3676 Details

Name: GLEAN_3676
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:218703..221128 (+ strand)
Length: 2426
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:218703..219363 (+ strand)
Length: 661
Type: CDS
Source: GLEAN
Position: GCSC_113:219444..219530 (+ strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_113:219604..220068 (+ strand)
Length: 465
Type: CDS
Source: GLEAN
Position: GCSC_113:220128..221128 (+ strand)
Length: 1001
>GLEAN_3676 class=GenePrediction position=GCSC_113:218703..221128 (+ strand)
ATGAATTTCGATGATGGCCATCACTCGTCTGTCCCGCTCCAGTGGGGTATGTCTTCGAGCTCAAACCACCGCTCTTCTTT
TTCTTCCGACTTCTCTGTCGCTACCTCGCAGATCAGCAATGGCCCTCTGTCGCCCATCAGCACGGGCATCGACATACCCA
TTTCTGCCTCCACAAATGCTGAAACCTATCTGCTCACCGCGCCCAGCAGCCTGTCCTCTGCGCCACCATTGGATACCTCG
ACATCGTCATCCTCTGCCACCCCAGAGAACTCCACATCGCCAGTTTCGCATGGCTCGCATGCGTATGGGACCAATGATCT
CGTTGATTCAGACGTAGGGCCGGACAGCCCTCTCGGACATATGAGTGATATGCATTGGGAGACCGCCGAGATCGACCATT
TGCATATTCCCAAGCTGGAACCCATCGATGAGGACGACTTCCGCCTAGAAGACCTGAAAGAGGCACCTGCGCACCCCGAA
GCACGTGGCGAGACTGAGATTCTTCCTCAGTCCAAAGTCAAACGACCTCGAGGACGACCTCGGAAAATTGGCGCTATTCC
CACTTCGGCCTCTGTGAGCAAGATGAACAAGGGCCGGTCCAAGACTGGCTGCATCACCTGTCGCAAGCGGAAAAAGAAGT
GCGATGAAGCCAAGCCAAGATGTAAGAGGCAAAATTCACCCAACTGTTGCGGTCTGCCCACTGCAACACAACGCTGACCA
GTAACCTGCTGTCCCTTGTAGGCTTGAATTGTGAGAAGAACGCCGTGATATGCGAAGGCTATCCCGAAAAGCAGATCTGG
AAGAGCGGCAAGGAGAAGGCCGAAGAAGGTGAGAGCTCTACTTACACGTTTGTGTTATCATTATCGCTTGCCGTCAGTAT
CGCTTACCAGCGCGCTTGCAGAGCTTCTCAAGAACCACAGCCTGCCGATTATCACCATGCAGCCCATCTTCACCGGCTTG
GAAACATCAGAGGACCGTATCTTCTGGAAGCACTACAACGACCATCTTAGTGCCGTGTTCACCGTCGAAGGAGAGCAAAA
GAACGCATTTCGAGACAAGCTCGTGCCCCTGGCCACGAGGCATCAGGGCATGATGCACTCGCTCTTGTCCCTCTCCAGCA
AGCACCTCGACTATGACACGCCCTACGGCGCCAAGATCCTTCAGAGAACCACCAAAGTTACTGCCGATTCTCTACAACGA
CGTGGAAGCCACCATAACAGTATGGCCGTGAAGTCTCTTTACGACGCCATCAGTGAGGACCGGAATAACAACGTCGACCC
GAACGTGATGCTTGCTGCCCGCTATGGCCAGATGCTGTGCCTGGTGCTGGAGTCCCTGGCCGAGGGAGTAGGCATCGGGG
GAAGCGGTCCGCGCTGTCACTACGACGCGTTCCTGTTATTCTGATTGCGAAATCTCCGCCCGGAGACTCGGATTTTTACG
CCTTCATTGTCGAGATTTTCTTCTATCACATCTTTGCCGATGACCTCCTGAGCTTCCCACCACACACAAATCGCGCCTAT
GTTGGTGGCAGTGACTGGACTCCGCCTACACCAATTCATGCACCACGACTCATCGGCGTGGCTGATGGCCTTTTCAACCA
CATTAGTGAAATCACCAACATTCGAATTCGCATCCGTGAAAGAATCGAAAACAACACTGATCCGAGAGTAGACTATGACA
GCCTGTATCGTGCATCTGATATCGAGTCTAGCATTCTCGACTGGTCGCCACAATGGCCAATTGGCGATAGCCGGGAAAGT
GTTACGCTGCTTTATAAACAGATGACCTGGCTGTATCTGAAGATGACGATATGTCCGCCATCTTCGAGCCCGGATTCAGC
ACCGACTATCTTGACGCGGGCTGGGGCTACCTTGACCGACACGCCCCCGCGGTCAGCCTCGTCTAGCCCGGCTTCTTCAC
CGTCTCCAGGAATAGATGCAAGGGTATGTGATTACGACAACATGGACGACTCGCGTCGCCCTTCGTTAGCCGACAACGGG
GCTAAAAGCGACGCCTCCCCCAGTTCGCAAATCGACGAAAATGTGCAAACAATCAGACAAAACGGTAGCAGCGATTTGCG
TGCATCTCCACCACCAATCCGCCGTCCAACGAACTACGAGCCGGTGGTAAACGTGGCCGTGGACGAAACCCTGGCGCTTC
TCGAATCCTTCCAACCAAGCGACCCAGCCCAGACCCTTCTGCTGCTTCCTTGTGTTGTCGTGGGTACCGCCTGCTATGCA
CCAGCTGAGCAGGCTCGGATCTGTGAAGCCATCCACACCATCCACGGCTACACCGGACTCCGAAACACGAATCAGGCCCT
AGAGGTCTTGAACGAGGTGTGGAGGCTCATGGATGCGGGTGAATATCTTCTCGCATGGGACTGGCAAGCCGTGGCATACA
AGCTGGGGCATGGATCTCTTTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62