GenePrediction:GLEAN_3677 Details

Name: GLEAN_3677
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:227465..229776 (+ strand)
Length: 2312
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:227465..227785 (+ strand)
Length: 321
Type: CDS
Source: GLEAN
Position: GCSC_113:227857..228396 (+ strand)
Length: 540
Type: CDS
Source: GLEAN
Position: GCSC_113:228763..229776 (+ strand)
Length: 1014
>GLEAN_3677 class=GenePrediction position=GCSC_113:227465..229776 (+ strand)
ATGACGAATTCGATGGTGAGGGGCCTGGAGCGGATTCATGCGTGGCGACAAAAGAATTCTGACGACAGCGAAAACGACGG
AAATGAAAGCGAAGCAGCAGCAATAGCAATAGCAACAGCAAGCAGCAGCGAACCAAGCCTCGATGCCCCTGCCGTCGGCA
AGCCCATATCCCATGGGCAGGTGGTGGACTTGTGGGAGATACTGAAGCGAAACGAGTCCACTGACGAGGCCACCGATGCT
GCTGCAGCCCCGACAACCCTGGAGGCCCTTCTGGTCGGTGCCAAGGTCTACGTGCCACCACCATCGCCGAAGCCGGAGCC
AGTGCGTGTCTCCTTCCATTGCCATGAATTTAGCTTGTTGCAGCTGTCTGACCGTTTCTTCGCTTCGCGCAGTCCGACGA
GTACAAGGCCCTGATGGCCCGGCTGCGCCACGACGAAGAGGCCCGAGCCTACGAGCGCATGGTCAACCCGCCCGAATACC
ACGCCGCCAACGAGGCCTTTGCCCGGGTCAACCGGCCGGTCTATTCTGCCGATGCGGGCGACGACGAGGTCACGCTCAAC
GATGTGCACCGCCAGGTCATGCTGATTCTCAACTTTGTCCTCACCATGGGCGGCGTCGCCTACACGCTGTGGGTGCTGGC
CCGCTGGTGGCCTACGCCGTCGCGGCTGTTCTTGTCTATGGGAGGCAGCGTGCTGGTCGGCCTGGCCGAATACGGTCTCT
ATGCCGGCTACGTCTGGCATCTGTCCGAGGCTAAGAGCAAGGACGAGAAGGAAAAGGAGATGGAGACGAAGCAGGTGCTG
CGGACCTGGCTCGTCGGCGCCGCCGGTGTGGAGGAGAAGACGGCAGACACTGCGTCCGCACTACCTTTTGATTCAAAGCT
CTCGTCCGGTGCTGCAACAGCGTCAACAGGAATGGCAGGCGACGAGTTGGGCGTACGGAGACGGAAACCGGAGCTGCCAG
CATCATAGAACTGGGCCCTCTCTGTACACCACACGTCCAGCATGTCTACTCGAACAGTGATAGCGCTCGGATCTGCCCGA
TCACACCATGCTTCCATCTTCGCATTGGGACTGCCGAAGGATGAATAAAGTTTTACGCATCGTCACGTGACGCACATGAA
AACGCGACCCTGTCTACGCGTCTTGGACCGTGTCTCAAAGCGGGGCACTAACTACGACACGACGATGCAAGTTCCATGTT
TCCACCTCTGCCAATTGCCCCTTACACAGTCGAATGCATCATTCTTAATTCCCCCGATCGGACGTGTGTGTTTGCGCAGT
CGTGTCTCATCAAGCCAGAAAAGCGATCTGACGCTGTATCGACACGCTGCCGAGCCATCAGCTACGATGGGACTCATGAC
GCCCGACACGCCGAGCTCACGTTCACCCACAAACCCAAAGACCATGGCAGCATCAGCAGCATCATCACCATCGTCATCCC
CTACACCCACAACGCCATCGACAGACATACCCCCGCCGCGGAGACGCACGATCCGGACATACGGCAAGAAACGTCCGCTC
GCAGACAGTGCAGATGAGGATGGCCGCCATCCAGCACCTTCGGTGAGAACGGCCAATGCGGCTTCTGACAGCGCCGAGAC
GGTGAAGCCGACCTCTTCCAAAGTGCCCTCGCCGCCGTCGACGACGGCAAGCGATGGCAGCTCCAAAAAGCACAAGCGGT
CCGGCATCCTGCGATACTTCCAGCCGGCACCACTGCCCCGAAGCTGCACCCACACAACATCGTCCTCGTCATCACAATGC
TCTGCCGGCGAGTCGGACCGGTCTGCCGCCCCAGAAAGCACATCACAGACGGCAGCAGTCACCGGTACACCGCCACCATC
GCCGCCGCGGAGTCCTCCAACAGCACGGCCTCGTCAGAAGCGACGGTTGAACATACGGCCGGACATCCCTGATGTGTCCG
AGAAGAAGGCAGAGAGCGACACGAAGACGGCAAGACCGGAGGAGGATGCAAAAGGCGACGGTCAAGACCGGCAAAGCCAG
ACCGGCAGCGGCACCACAGCATCGAGCGTCCGGATGCGAGCACGTATGCGAGCGAGGATGCTCGGCATGTGTGGACTGGT
CGACCAGGAACAACAGGCATCGGCACGGAAGAAAACTCCCACGCCGGCAGCATCAACGCAGACAACGCTGAGCCTCACGA
TCGGCGGCGACGCCATGAAGGAGTGCACCGAGTGCAACATCCTCTACAACCCGCTGCATGAGAAGGACGCCAAGTTTCAT
GCACGATACCACGCGTCCCTGCGGCGGAAACGGGCGCGACAGGAAGCTGCAGCTGCGGCAAGGACAAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62