GenePrediction:GLEAN_3679 Details

Name: GLEAN_3679
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:246047..249339 (+ strand)
Length: 3293
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:246047..246188 (+ strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_113:246484..246925 (+ strand)
Length: 442
Type: CDS
Source: GLEAN
Position: GCSC_113:247060..247531 (+ strand)
Length: 472
Type: CDS
Source: GLEAN
Position: GCSC_113:248002..248185 (+ strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_113:248252..248342 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_113:248406..248519 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_113:248639..248720 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_113:248860..249339 (+ strand)
Length: 480
>GLEAN_3679 class=GenePrediction position=GCSC_113:246047..249339 (+ strand)
ATGGCCGCTGAGCGCGAGGTTCGCTTCCTGTGGGCGCCGGGGGGGATTTTCCGAGAGCGTTTAGAATGGAAGTCGCCTGC
AAGGTTGGGGTCAGAACTAATAGAAAATGAGAGGATGATGTTTTACGGGCCTTGCCTCAAACGTAGGTGCATAGACGTAG
CACCTGAAGATGCAATAGCAAACTAGCTGACGATCCAATCATTCCCAAGAGGTGATCTCGTGGGAGTTGACGAAGCAGGG
TGTTTGCATAAGTGAACAAAAGATTGTTTAGTTGGATGACTTCGCGTTCGCACCTGGTATGTTGCATAGGACATACCTGT
TGCACCTGCCTGTTACGTCTACACTGCACCTGCCTGTACACATTGATTCGTGCTAGTCCACGTTCATCTGCCTCGGTCTT
TCCGCCTATCTTTCAGCATGTCCGCAATGCAGCTCAGATCTGATTAGGCGGCAGCACGATGTTTCGCTTCTGGTCCAGAC
GATCCATGGCGCCCGACACGGCTCGCTTGGTGCTGCTTTGGGGCTGCGATATGCCGCTCTCACATGTCTATTCCTGGGCA
TCGCCGTGCCGGCTCATCCGGTGAAGTGCTCTCAGGTGGCCGACAGCAGCATGACACTGGTGGCAGCGGGTGAGAGCAGG
CCGACACGATCGCCCAACACGGCCGTCCGCTGGCGGATCGTCAGCATGGGCCCCATCACCGGCCTCAGTCTTGTAGTGCC
ACAGGCGACCATGACGCCCATACACGTGGATGGAGGCCACCCAGTGGCCGCCGTGTCTGGAGACGGCATCGGAATTCTCT
ATCCGGGAAAACGCGTCGACCTGCTGGTCACAGAACCGGCAGACATACCGTTGCGGTTGTACAATGACATGGACTCAGAG
TAGGCAATTCGGTCATTTCTGTACGCACGGAGAGACAATTGAACTATAGCTTACGGCAATGGGACAGGGATTTGCGATAC
TAGATTTCGACCCTCCGGCCCAACCAATCGTTCCCGATCACTAGATAAGCCAGCCAGAGTGTGAAGGAGGAAGACGAAAA
GACACGACCGTTACCGGAAGCCCCTACAGCCGAAAGCACAACGCCGACGGACTGGCCGATGCAGCAGGCGGACCAAACAT
TGGTGGAATACGCCAAGGTGCAGCTGCTAGCCAAGTTTGGCAACAGGCCGATGGGATTCATGAACCACTCGTCGTGGAAC
AAGGACCAACTGGTGCCATTTGTGGCGGGGAGCAGCAGCGGCGCCTGGGTCGACCTGGTGATCAACAGCCTCGATGATGG
CGGCCACCCGTTCCGCCTGCACGGCCACGCCATTTACGTGCTTTTGCGCTACCAGACTAGCAGCCGCGTCTGCTGGTGCT
CCTGCAACCCGTTTGACAGGCACAAGACGCCGCCGGAAAGCGTCGACATGACGGCACCGCTACTCAAGCACACGGTGTTG
GTGCCGCAGCGTGGTCACGTGATGTTGCGGTTCCGTGCCGACAACGTAGGCAATTAGATGCTGCACTGCCACATCGCTGT
GCATCTGGGCAGAAGACTGTCAATGGCTTTGCAGGTCGGCAGGCCCGATAGGAAACGGCCAAGCCAGCACTTGTGTGGGC
GAGGATAGCTGCTGGGGGTACGGCGTAATAATACTGGGTGGGCTATATTAGCGGGGATTATTCGCCAGGCTTACGGAGTA
GAAACGTGCCACGGAGAATTATAATCATTAAGTCTACAGGTGGATGTCACTGCCCAAATATGCCAGTTGTGTGGGAACGT
GCCGATGCGCAGACCCATGTAGGGATCAGCAAGCTTGACACGGGGCCGTCTGTTTGAGTGTGATTGGTCCGGCCTCTACC
CCATGTTGTATAATGCGTCGATGGAACGTAGAATTACTATACCGCAAGCACGTGGGACCAGGGTGAGAGAAGGGCGCCGT
GTGGACGGTTGCACATACAACGACTGCTGTCGTAGTGGTTAATGTTTAGTGACAAGGCAGTGTCCAAAATGACCGTGTTC
TCGAAACTCGCAAGTGCAGCCGCGGTCGTCCTGCCACTGGCGGAGCTTGTGCTGACCGACTCGCTGGCCGACATTGAGCA
TGTGGTGCTGTTCATACAGCATGCGTATGGCTGCGGCCTGACTGCCAGCTCGGTGGCTGGTGATGATGTCGACTGACGTG
GTGCAGAAAACCGGACGTTTGACCACTACTTTGGCATGATGGCAGGAGTGCGCGGGTTTGCAGACCCGAACGTGCAGGTG
GACGGCAGCACGGCGGTATGGACGCAGCCAATCAACAACACGACGACGCTCAACCCGTGATACATCAACTACCCAGGCAG
CAGCTGGCACAACGCGACACAATGCATGGCTGGTGGCAGCAAGGGCTGGAGGGCGAACCAGCAGGCGCTGACGCACGGGG
CCAACAACGCATGGGCGGTGCGCAACACGCTGTACAACTGGGGACACATCCGCCGCAACGAAATCCCGACGCAGTTTGCC
ATTGCCGATGGCTAGACAGTCGGAGACATGTATCCGGTGGGCGTTTGGACGGCATCGTATCGTATCGTCTCGATATCACG
TGACTGACAAACACAGGAACCACAACTCACAGATCCTCTTCATCGAGTAATGGCAGGCAGCTCGAGGCAAGAACGTCACT
ATGCCCGAGATGGGCCCTGGCGCCGCGCCCACATGTACGATTTCACGGCCGCCTTTGACTTTTCCGCCCCCGACTACAAC
CTGCCCGAGCTGCCCTACGCCGTTCCCCCAAACAGGACTGCTGCTGGTGCCTACGATGGCGCTGCCTACTGCGAGGCCTC
CTACCCGACCTAGCGTCCACCTGTGCCCTACAATGGCTTCGTCAGTGCCGTCTCCCTCGAGGACGTTCCCGCTCTCGCTG
AGGAGGGCTACAGAGCTGTCCGCGGCCGCATCACCGAAAGCTGCTACCTCGTGTTCGAGTCCAGCTCCAGTGTGCTGACT
AATCATGCCTCCGCCGAGCGAGTCGCTGCCTCGGCTGCCACCGCCAGCCACGAGTCTGTTAGTCAGCGCAGGGCTGTCCA
CGTGCTCGAGCTTGGCACCAACAGTTTCCAGATCGGCAGCGCCCTCGATGGCCGTTGGCTCACGGGTAGCGGCACCCTTG
CCAGCGACGCTGCCAGTGCCGGCAACTTTACCGTCTCTTTTGCTGCCGGCCAAGGCTACGGCCTCCAGAACGGCTGTGGC
CGTTGGCTGACGGCGGCCGGCATGGGCGCCCAGGTCTTCTTTGGCCCCGACGTTGCCTACTGGAAGGCGTACAGTGTTAC
ATACCATGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62