GenePrediction:GLEAN_3680 Details

Name: GLEAN_3680
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:253017..254089 (+ strand)
Length: 1073
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:253017..253382 (+ strand)
Length: 366
Type: CDS
Source: GLEAN
Position: GCSC_113:253447..253800 (+ strand)
Length: 354
Type: CDS
Source: GLEAN
Position: GCSC_113:253916..254089 (+ strand)
Length: 174
>GLEAN_3680 class=GenePrediction position=GCSC_113:253017..254089 (+ strand)
ATGGCAGCCACTACGACGGTCGAGGTCCCCCACCTGGGCGGCATCAAGGCGGGCTACCGGCTCTCCAATGGCGCAGTCGA
CCCTACGAAGCCGACTGTAGTGCTCATCAACTCCATGTGCACCACATCAGCGCTCTACAACGACCAGTTCGACAGCAAAA
CGCTGACCGATGCCGCCAACCTGCTCGCTATCGAGCCCCTGGGCCACGGTGCCACCAGCTGTGCGGTCGACCACTTTACC
TACTGGGACTCGGCCATCATGGCACTGCAGGTCATGGATAAGCTGGGCGTGTCAAAGGCCTTTGCGCTGGGGACCAGCCA
GGGAGGCTGGGTCGTCGTGCGCATGGCTCTGCTGGCTCCGGACCGGGTATGTTCCATTCCTGTTAGGTTGTCTGACGTTT
ATCGTACATAGTACTTGCTGACACGCTCAGATCCTCGGCCTCTTCACCCTCGGCACCTCGATGGACAGCGAGTCCGAAGA
GTCACGTGCCAAGGGCGCATGGAATCCTCATGCGCAGCTCGGCAGCTTTTACGAAAAGTGGTGCTCGCTCGAGCCCACAC
CCGATTTTGTCATCGACGACGTCTGGTGCGGCGCCGTCGGCTCACTCGGCTTCGGCACCGCGGTCTCGCCAGAGACTATT
CAGTTCTGGGTCCGCACTGTCAAGTCTGTCTACGTCGGCGACGAGGGCCGCCGCAAGGTCAAGGGCGCCCTGCTCAACCT
GATGGAGCGCGACAGTCTGCTGTTGCGGCTGAGGGACATCCGCTGCCCCGTATACTGGCTGCAAGTAAGAAGCTTCGTCG
TCTTGTTTCCATTTTTCTGCGGGGCCTCTGCTTTGACCCCTTTCTGCCCTGCGTTTCCATTTCAAGTTTTGGAGTCCTGA
CCATGGACTGACATTTCAGGGAACCGACGATGTCGTCTACGGCGTGCAGATCCCCAAGGACCAGATCGAGTTGTTCACCG
GCGCAAAGGAAAAGAAGGTCCGGTACCTGGAGCAGGGAGGACACTACCTGAATGCTACGAACCCCAAAGAGGTGGAGGAG
GAGATCCTGGAGATGATTAACAAGTACAATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62