GenePrediction:GLEAN_3681 Details

Name: GLEAN_3681
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:256877..262104 (+ strand)
Length: 5228
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:256877..259817 (+ strand)
Length: 2941
Type: CDS
Source: GLEAN
Position: GCSC_113:259877..262104 (+ strand)
Length: 2228
>GLEAN_3681 class=GenePrediction position=GCSC_113:256877..262104 (+ strand)
ATGCACCCCGATCACTCCCGCCCTTCCCAGAGGAGGCGGCCAGATCTCACTATCAACACATCACGGGCTACAGCCAAATC
CACAGGATCTGTCCCCCCGTCGCCGCCAACCCGAAAAGCCGCAGTTTCTGGCGCCAGGGGTGGCAGTCCCAATTTCGCCT
CTACCGCGACGGCAGCCACTGCTACTGCCGCTGCCACGACTGCCCCGACGCGTGCTATTACCGCCCGAAGAAGCAGTCAC
GCGCCAAAGCCGGCCTCGTCAGACGCCACAGCGGCCGAAAGCGGGACCTATCACGATTACCACCCACACGTCAACATGGC
TGCCAGCAGAGAGAATGGCCGGACCACGGCTGACATGCCCCATATGCCGGGACAGCGCGATTCGCACGACCTTTCGCTGC
CGTCGCGCCACGTCCGCGACTCGCTCGTGTCCAACATGCTGCTCTCGCTCGACCAGTTTTCCATGGGACAGCTGGGCGAC
CCATTGAGCTCTGCCGGTCCGTCGCGCACTGGCAATTCGTTTGACGACCGCCTCTACTCCATCTCCACCTCGGGCACCGG
GGAGGATCTGTCCAGGATCAACACGATTCCACCGTCTGTTGCGCGTGGGGCCGCCCGCCACGGCTACTCGTACAGCTCCG
ACTACGAGGTCGCCGATGACGCTAGCCGTGTTTCCGGCAGCATCCATTCACGAGGCCATCGCAGCAACAGCAGCTCGGGC
TTCCAGTCCAGCCTAGGCCGCATCAATAGCATGCGCGAATCGCTGCATCGCGGCAGCCAGCCGGGCACGCCCCGGATGAT
GCACTCACGGGGAGGCAAGGCTAGCAAGAGCAGTAGCACCAATAGCATCGATGCCGGCGGCTATGTGCAGGTGTTGGGCA
GCCAGCGCTGGGCTCACGGCTTCGGTCGCCGCTCGTCCAGTTTCGACATGGGCCAGCAGCGGCCAGCCCGCAGCATGTTG
GGCAATGGTCCTCCGCCGAGCTTGATTCCGGGCTCGGGCCCCATTGAAGGCTCTTCCTCCGGCGGCGGCGGTGTCAGTGG
CCTACAGCCATGGCATATTGACTTCTCCAATGCCTTTTTCAACGAGAACTACGACGATGCCGCTCCGACACCAACTGTTC
CTGGCGGTCCTCGCAAGCTCAACTCCGTGCCGTCCATGCCTTCGATACCGTTCTACCAATCCGCCTCGAGCGACTCAATG
GGCGACCCGCGAGCCTCGATGCGACCACCTGAGCGCCGACGTAGTGTGCGGTCGTCAAAAAGTGCCACCGTTGGCCGCCA
GCCCCCAGCGAAATTCGCCTCTACCGCTCCGCCGCTCCCCGTCTACGATATCGATTCGGCGCCGGCACCACACATTGGCT
ACGAGAAGACCAAGGACGCCGCGTCCCCTGCCATGACTCCTGCCCAGCAGCAATTGCTGCAGCAGCAGCAACAACAGCAA
CAACAACAATATTTGCAGTTACAGCAGCAACAGCAGCAACAACAACAGCATCAAAAGCCTGGGTTCTTCAGGAGAGTATT
TGGCTCTTTCCGCGATACCGTCGCCGGCTCCGAGCAGAGCTCTTCTAATACAGCCGCCCCAGCCAACTCGGCCAACTCAG
CCTTTGCTCTTATGACAGCCGAAGCCGCAGGCAGTCGGGTTCCGGCCGGCAAGTCGCAAAGCACACCGCCATCGCGCGAC
AGCCACCATTCGACACATGCAACGATACAGAAAAAGCCGTCCGGCTTCTTCCGACGGCGAAAGAAGAGCGTCTCGGAAAT
CGATGGCCCGCCCCCGCTACCAGCTGCCTTTGTGCAGCAAGCAAGCCCACAGCCACCCCCTCCACCACCCCCATCTAAGA
CGCAACCGGCAGTCCCACCGGCCCCGCCACTGAAGCCCCCCGCATTGCGGGACGACCGTCTGCTTGACGGCCAGGCTGAC
AGCCCTGCCACGAGTCTGCGCCGGGCTATGAGCCCTTACTTGAAATACAGCTCGTCCTTCCCGAACACGTTGGCGGGAAA
GACTGGCAGCCCTCTGATGTTGCAGAGCGACGATCTGTACGACGCAGAGCCGGAGCAGACAGCCGCCCAGGGCGCAGAGG
CGGACGATATGGCGGCGCGTGCCGTGAGAGGCTTTTCGCCTGACTATGAACCATCCCCGGACGCGACGATCCGGTCAGTC
GAGCCCGAGCCGACTGATCCTCACCACCGTCTGGCTACGCCGTTGCGGGAGCAACCAAATGCGCCTCACCCGGCGCGGTC
GGGCTCTTTCCTGAGCGACAACAGCGACGACGAGGACAGCCCTCGCCGTGTTGCGAAGAAGACGCTGGCGGAACAAGGAG
TGAAGAAGCGGGGCAGTCGAAGCTCACTGGTGGCGTCGATCATGGGCGATTTCAGTCTTTTGTCTCCGACGACAGCACAC
CAACGCAGCAAGGAGCGTACCGGCAGCAGGGCGACACAGGACGACGCCGAGTCGCGTGGCTCCCGCCTGAGCCTTCCGGT
CGAAGGGCCGATTGCGCCCCGTAGCAGCACACGTGGCTCGGACACGGCAATTCCACGCATGCCGAGCCTGCAGTTCGATG
CACCACCCAAGAGCAAGCCCGTTCCTGCACCCATCGCCACTGGAACGGCCAAGGAGCTGATTGACGAGCCGGAGTTTGTC
ATTGGCGACCCGACCGAAGACGACCGGAACAAGGCGTTGAACATCTTTGAGGGCAACGAAGACTTCATCCAGAGGGGAAA
GGCTGCGGCTTGGATGGGCGAGGAGGGACCGGTGCGCCAGCGAACGCTACAGGCCTACATGGACCTGTACAACTTCCAGA
ACCAGAGCATCGTTAAGGCTCTGCGCGAAGTCTGCCGACGGCTGATCCTGCGCGCCGAAACGCAACAGGTTGACCGCATC
CTGGTGTCGTTTTCGAAGAGATGGTGTACCTGCAACCCCAATCATGGCTTCAAGTCCATGGGTACGTTCTCTGGCTGATC
TGCGGCTCTGTTTTCTTGTGACTAACTATTTGGCACGCAGATGTTGTCCACACGGCCTGCTACTCAATCATGCTTTTGAA
CACGGATCTGCATATGGCGGACATCGAGTCGAAAATGACCAAAAGCCAGTTCATCAAAAACACAATGACCTCTATCCGGC
AAACGGCGGGAGAATGCTCGCCCACGGTGTCGAAGCGGCCGAGTATCTTGCCTGGCAGAGGCTCTGCCTTCTCGAGCAGC
AATGAGGGGAGCGGCAAGCAGTCGGCCATGAGCCAAGCGAAAGAGTACACAACCGGCTTGGGGCTGTCGGCGTCCTCCTT
CCTGCCGCCGCGGTCGGGATCGTCGCAGGGCCACCACCACGATGAGATTGGTCCGTTGATCAGCACTCCGTTTGACGGCA
CGATGCACGCATGGGAGGCCCAGATGGAGCTTGTGTTGAGGGATATTTACTCGTCCATCCGCGACGAGCGGCTGCCCCTG
TTCGGAGCGGATAACAGCCAGGCAAGCAACCAGAACGGGCTGTCGGTCAAAGGCATGTTGAAGCGTACGCCGAGCGTGCT
GAGCAAGACGCCGTCGGAGAGCCAAATGTCGACGCGCGGGCGAGTGACAGACCAGAATGGGCGGGCCAGCTCGTCCCGCT
GGACGTCCAAGAGCCGGTCGAGGGCGCGGGTGACGACAAGCAGCGGCGGCAACAACGGATTCAACTCGAGCCGGACGAGC
TTTGACGATGCGAACTCGATGTGGAGTCCGACGGCGTCGTCAGCGACGTGGAGCCGGCAGTCACTGGGTCGGACACAGGC
GTCGATGTCTATGGAATCGTTCAATTCGTCGTGGGGCCGGGGAGACTACCAGCAGTCGATCGGGTTTGCCAACGCTCTCA
GCCAGGCGATCATCCGGGAAGACGGGCTGAGCGCGGGCGACGAGCAGTCGGTGCACCAGAAGGACCACCCGCTGCTGGAT
GACGAATCGCTGGAGCTAGCAGGGCCACCATGGGTGAAGGAGGGGCTGGTGGTGCACAAGCATCACCTAGGCGGGACGGA
CAAGAAGGCCAAGGACCGGACGTGGAACGAGGTTTTTGTGGTGGTGCAGAAGGGCCAGATCAGCCTCTTTTCCTTTACGC
CGAACAAGTCGATGCGCAGCAAGAACCGCGGCCGCGGCAATGGGGCCCTGGCGCCGGGAGCCGTCGTTGGCGGCGGCAAC
TGGCAGGACAACGCAACGAATCTGGGGACGTTTGGGCTGAAGCAGTCGCTGGCATCGGCGCTGCCGCCACCAGGTTACTC
GCGACAGCGGCCCAACGTGTGGGCGCTGAGCCTGCCGACAGGGGCGGTGCATCTGTTCCAAGTGGGCACGCCGGAGATCT
GCAAGGAGTTTGTGACGACGGCGAACTACTGGAGTGCACGTCTCAGCACCCATCCGCTCGTGGGGGGCATCTCGAACATG
GAGTTTGGCTGGAGCGATGCGGTCGTGAACAATTCGCTTGTCAGTGCGATCAACCACAACGGGTCGAATTCGGCGCTTCC
AGCTCCACCGGCAAGCAGCAGCGGCGTCAGTCTCGCCGGAGGCGGCAGCAGTGGCAGCGGCCTCGGGCATGGACTCGGGC
TTGGGGCTAACAACAACAGCAGCACGGGACTTGCACAGGTTTCGCGGCCGGGATCGGCAGCGGCTGGTCGGACAAGCCTG
CAGTCACGTGGCTCGTTCCGGTCGAGCTCCTTCGACTTTGGTCACGTGCGTAACGGCTCGGCTTCGAGTGCTAACGGGAC
GTCAGCGCTGCATGGCGGCGGTTCCAGCAGCCGGCACGGCAAGCTGCCGGGCGACCGGATCCATATTGCGGACTGGGCGC
CGCCGACACAGTCGATGCGGCCGTCACACGCGGCCGAGGCGCAGCAGCTGCAGACGCTGCTGGCCTATGTGAAGAGCATC
GAGGACGAGCTGCAAGTGCACAACGGGCTGCGGTCGCCGATGCTGCTGGCCTTTTCGCCGCGCGGCCAGAACGCGCAAAA
GGCCCTGGCCAATTGGGAGCGCAAGAGCGCGTATCTGCTGCGCGAGATTGTCAAGTACCACACGTATGTCGACTGTCTGT
CGGAGGCGGCGCGGCGGCGTGGCGAGATCTACCACGAGCGCGACATTGCCCGGCGAGCTGCCCGGGGCGAAGACGGCGAG
CCGACGGACGTCGAGGACGACGGCATGGCTAGCGACGAAGACGACAGCGGGCTCGAGTCGGAAGACGAAGACTATGCCGA
CCATGCCGACGAAACGTTGCGGGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62