GenePrediction:GLEAN_3682 Details

Name: GLEAN_3682
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:262783..264549 (+ strand)
Length: 1767
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:262783..263043 (+ strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_113:263103..264331 (+ strand)
Length: 1229
Type: CDS
Source: GLEAN
Position: GCSC_113:264381..264549 (+ strand)
Length: 169
>GLEAN_3682 class=GenePrediction position=GCSC_113:262783..264549 (+ strand)
ATGTCATCCATCGCCTCCTCCCAGGATGGGGCCGTTTTGCGGCTGGCAAGCTGGATATCCGACCAGCTGTCGGCCTCGAG
AATCGCCGCTGTTGGGGCTGTTCTCTTCCTGACAACGTTTCTGATCGGCTGCACCCGGCAGCCTCGCTACCCCAAATCGT
TGCCGCGCATGGGCTATGGTGATGGCCCGTTGGCAACGCTGCGCAACTGGGTCGCCTACACCTTTCACTTCCACGAGTGG
ACCGAGGAGGGCTACCGGAAGGTGTGTTTGTGTTTGTCGTCTTCGTCTCCGTCTTCGGCTCCTGCTGACTGTCTGCCCAG
CATTCCAAGCACGGCCGCACATTCATCGTTTCCTCAGGCCCGTCGTTGCCGCAGGAGATGGTCGTCCCTCGGTCGCAGAC
TGCGTGGATGCTCGACCTACCCGACAACATCCTCTCCACGGATGAGGCTCATGATGTCGTGCTGCACAGCAAGTACAATC
TACTGCTGGGGGTCAACAGCAGCCACCAGCACCACGACGGCTCCTTCCACAACCGCATTATTCACCGCAATCTGGCCCGC
CACCTGCCCGGCCTTCTGCCGGCCATCGAACAGGAGGTCGCGGCAGCAGTCGACTGTGCCTTTGGTACCGGCAGCGATGG
CGAGACCGGCGACTGGCACACGGTCAACCTCTGGGATGCCTGGCTGGCAATGGTGTCGCGCGTGACGAACCGCATGCTCG
TGGGCGAGAACGTGTGTCGAGGGCCACACCTGCTGCAGCACATGATCCGCTTCGCCGACGTCGTCGTGGCCAACAGCTTT
GTGCTGGGTATGTTTCCGAAGCTGCTGCATCCGCTCGTCGGCCGGCTACTCTGTCTGTCCAACTGGCGCCACTGGCGTGC
TGCGCACAAGATGCTGGAGCCGCTGATCCAGGACCGGCTGCGGCAACTTGCTGCCGGCGACGAGGCCGTGTCCGAGGACT
ACATCACGTGGCACATCCGCACAGCCATGGCCGAGGGCCGTGTCGAAGAGCTGACGCCGGCTGCTGTGTCCCGGAGCCTG
ATGCCGCTCGAGTTCGCCGCCATCCACACAACCGTATTAACGGGTCATTCGCTGCTGTTGGACCTGCTGTCATCGGACCC
GTCTCGCGGCTTCATCGATGCCATCCGGAACGAGGTCGGGGTCGTGCAGTCGGCAGACGCTCCCTGGACAAAGGCCCAGC
TCGGCCGTCTGTGGCGAACCGACAGCGCCATTCGCGAGAGCATGCGCATCAGCAACTTCGCCACGTCGCTGACCAAGCGA
AAGGTCGTCGCGCCTGGCGGCCTCACCAATGTCGCCGAGGGCTGGCATGCTCCGTACGGCAGCTTTCTCGTCCTCAATCT
CAGCGACATGCACCACGATCAGGACCTGTATGTGGACCCGGACTACTACGACGCCTTTCGCTATTCCCGCATGCGTGAAG
AGGCCACAGCTGGCCCTGCCGTTGACGGTGGACCGGCCAGAGGCAGTCAGCTGGGCATGGTCACCACGAGCGACCGACAT
CTCGCCTTTGGCCATGGTCGACATGCTTGGTGAGTTGAGTTGAGCTTGCCTCCCTATTTTCTCTTGGCTGACAAACAGTC
CCGGCCGCTTCTTTGTCGCCCACGAGCTGAAGATGATCCTTGCATACCTGCTGGCCAACTACGACGTCAAGCCGCTGGCA
GAACGCCCGAAGCCCCGCTGGATCGGACAGACCATCATTCCCCCGCTAGATGCCAAGATTGAGGTGCGCAGGAGGACGCC
GGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62