GenePrediction:GLEAN_3683 Details

Name: GLEAN_3683
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:270693..272353 (+ strand)
Length: 1661
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:270693..271147 (+ strand)
Length: 455
Type: CDS
Source: GLEAN
Position: GCSC_113:271243..272353 (+ strand)
Length: 1111
>GLEAN_3683 class=GenePrediction position=GCSC_113:270693..272353 (+ strand)
ATGACGGCAGACATGCGTCTCTTTGAAGACGAACGTGCTGCATTTCTGCACAGCAACACGTCGTCGTCGTCGGCCCGTCT
GTCGTCGTCCTTTTCGTCCCTTTTCGACTTTGAGGACGAGTCGCTCGACGACTCTCACGATCCTCATGATACCCTCCTCC
ACGAGAAGCCCGACGTGTCCAGTCTCCGTCGCAAGGCCCAACACATCCTGTGGTGGATTCGCTGGCACCGTCGTCCCGTC
CGCCAGCTGGCCGTCTTCTTCCTCAAATACACGCTCATCCTCATCGTCGCTCTCCTGGTCTTGACTCCCATCATCTGTCC
GTCCTACCAACATCCTCCATCCCATTACCACGACCTCGAGGAGCACTGCCGCGATCTCGGCTGGCAGGGCCACAACCCGG
CGGCCAGCGGTTGCGCCAATGCGTTCAACGAGACCGTCTTCATCGCCGTCAGCCTGTACGACGAGGGTGGCCAGCTGGCC
GGAGGCCGATGGGGTCAGGCCGTGCTGGACCTCATTCACCTGATCGGCCCCGGACCCACGTCTTCCTCAGCATATACGAG
AACGACAGCGGCGTGGAGGGGGCGGCTGCGCTTCAGGAGCTGCGCAAACGCGTGCCCTGCCGCAGCGAGATCGTCTACGA
CGAACACGTCGCAATGGACACCATTCCCAACATCACGATGCCCGATGGCACGGTGCGAACGAAGCGGCTGGCGTACCTGA
CCGAGATCCGCAATCGGTCATTGCGGCCACTGGACACGCTGGACGGCGTCGGCGCCACACGCTTCGACAAGATCTTCTTC
CTCAACGACGTCGCCTTTCGTCCACTAGACGCCGCCCATCTGCTCTTCAGCACCAACGTCGGCTCCGACGGCCGCACCGA
ATACTTGTCCGTCTGCTCGGTCGACTGGAAGATCCCGTGGATCTTCTATGACGCCTTTGCTCTGCGGGACGCCGAGGGTT
ACGCCGACGGCATGCCGCTCTTCCCTATCTTCTCCGGCGCTGGCGCCGGCCTGTCGCGTTCAGACATGCTCCACGAAAAG
GACGCCGTGCGTGTGACTGGCTGTTGGGGCGGCATGGTCGCCATGCAGGCAGCATACGTGCAGAACACGGATCTGGCCCT
GCCACGCCCAGACTTCCAGGACATTGGCAGCCATGTGATCGATCCCGATCGGCCGACAGCCATTTCCAGTCCCGTGCGCT
TCCGCTACGAGCCCGAGATCTTTGTGGACGCCTGCGAATGCTGCCTCTTCCTGGCCGACGTGTCGCAGGCGGCCCGCGTC
AGTGGTGCCCCCGAGACGAGCACGGGTGTCTTTGTCAACCCCTACGTGCGTGTGACATACGACTGGGGCACGTTGCTGAT
GGCGCGCGCCATCCAGCGCTGGGAGCGGCTCTTTATCGTGCCGCAGTTCTTCCTCACGCCCTACCATAAGATGCCGGCGA
ACAACCCGCACCGGACGGTCCAGGAGGGCGACACGTTTGTCGAGGAGGTGTGGGATGCCACGACGTCCGCCTGGAAGCTG
GTGCACCGCACCGGGCGCAGCGGCATGTTTTGTGTTGTGCGCGAAATGCTGCTGATGCGAGACAAGCGCAAAGGCGACCG
CAACTGGGAACGAGCGGCGGTTCCGGGAGGCCGGACATTAGATTTTCCGGCCCCTTACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62