GenePrediction:GLEAN_3687 Details

Name: GLEAN_3687
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:286283..287921 (+ strand)
Length: 1639
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:286283..286434 (+ strand)
Length: 152
Type: CDS
Source: GLEAN
Position: GCSC_113:286500..286700 (+ strand)
Length: 201
Type: CDS
Source: GLEAN
Position: GCSC_113:286751..287921 (+ strand)
Length: 1171
>GLEAN_3687 class=GenePrediction position=GCSC_113:286283..287921 (+ strand)
ATGCCTAGCCTCCGGAAGTTGGCCTTCGCCCTGCTGGCGAGCGGCATCACCCAGGCTGCCGCCTCCGATGTTACCCAGCT
CAAGACCGACACGTTTGCCGACTTTGTCAAGACAAATGATGTCGTCCTCGCAGAGTTTTTTGCTCCGTGGTGGTAAGTAC
ACGCCGATCCTGCTCCACTCAGCGTCCCCATCTCTCCCCTCCCTAACACGTCTTTAGTGGCCACTGTAAGGCTCTGGCTC
CCGAGTACGAGGAGGCTGCTACCACGTTGAAGGAGAAGAACATTATGCTCGCCAAGGTCGACTGCACAGAAGAGGCCGAT
CTCTGCTCGACCTACGGCGTCGAGGGCTACCCCACCCTCAAGATCTTCCGTGGCCTCGACAACATCAGCGCCTACAAGGG
CCAGCGGAAAGCGGGAGCGTAAGTCCAACTACTGCCCTCTGTCCTGTCTCGGTACTGACCCTCGACAGCATCACGTCGTA
CATGATCAAGCAGTCGCTCCCGGCCGTGTCTACGGTGACCAAGGACAACTTGGAGGAGTTCAAGAAGGCCGACAAGGTCG
TGCTGGTGGCCTTCTTCAAGGCTGACGATAAGGCGTCCAACGAGACATTTACCAGCGTGGCCGAGAAGCTGCGCGACAAC
TACCCGTTCGCTGCCAGCAGCGATGCGGCGCTGGCCGAGGCCGAGGGCGTGACCGCCCCGGCTGTCGTGCTGTACAAGGA
CTTTGACGAGGGCAAGTCAGTCTTCACCGACAAGTTTGACGAGGAGGCGATCCAGAAGTTTGCCAAGTTGGCGTCAACGC
CGCTGATCGGCGAGGTCGGTCCCGAGACGTACTCGGACTACATGTCGGCCGGCCTGCCGCTCGCGTACATCTTTGCCGAC
ACGGCCGAGGAGCGCAAGCAGCTGGGCGACGAGCTCAAGCCCATTGCCGAGAAGCACCGCGGCGTCATCAACTTTGCCAC
CATCGACGCCAAGACGTTTGGCGCCCATGCGGCCAACCTGAACCTGCCGACCGACAAGTTCCCGTCGTTTGCCATCCAGG
AGACGGTCAAGAACCAGAAGTTCCCTTTTGACATTGAGGAGAAGATCACGCTCGCGTCCATCCAGCCGTTTGTCGACGAC
TTTGTCGCTGGCAAGATCGAGCCCAGCATCAAGTCCGAGCCCATCCCGGAGACCCAGGTGGGTCCGGTGACCGTGGTGGT
GGCCAAGAGCTACGAGAGCATCGTGCTGGACGATGCCAAGGACGTGCTGATCGAGTTCTACGCCCCCTGGTGCGGTCACT
GCAAGGCCCTGGCTCCCAAGTACGAGGACCTGGCCGCGCAGTTTGCCGGCTCGGCCTACAAGGACAAGGTCGTCATTGCC
AAGATCGACGCCACCGTCAACGATGTCCCGGATGAGATCCAGGGCTTCCCTACCATTAAGCTGTACCCGGCCGGTGCCAA
GAACGAGCCGGTGACGTACAGCGGCCCACGCACAGTCGAGGACCTGATCAAGTTCATCAAGGAGAATGGCAAGTACGCGG
CCGACCCGGAGGAGCTCCTGGAGGAGACTGCTGCCGAGTCGACCACCGTGTCTGCCGGCACGACCGCCACAGCGACCGAA
GAGGCCGCGACCGAGGAGTCGGTGCATGATGAGTTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62