GenePrediction:GLEAN_368 Details

Name: GLEAN_368
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1337187..1338775 (+ strand)
Length: 1589
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1337187..1337262 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_167:1337529..1338775 (+ strand)
Length: 1247
>GLEAN_368 class=GenePrediction position=GCSC_167:1337187..1338775 (+ strand)
ATGACGACGTCTGCAGACGCGCCCATGGCTTCGGCCCCGACACCGTTCTTCCGCATTCTCGCGACCGCAGCCAGAGGTAC
CACGGCCGTCTCCTCCGACCATGGCGCCCGTTGCGGCTTGCTGGCACTTCCTCGGTCACGTGGCTTGCCGCTGTCAACAC
CTGCCTTTGTCGCTGTCACCTCACGCGGCTCTGTTCCTCACGTGACTCCCGACAATGCAATCCGCCATGATCTCTTTGCT
GCTGCCTATCTCGCCCTGGAGGACTGTGAGTGGGGATGGGACGAGATGAGACGAGATGACGATGCCAGATGAGACCAGAG
ACGGCTGACCGTGACTGTGCAGTTGTCGAGCAGGTGCCTCTGCAGCCGGACCGCACGCCGCCCATCCTAACGACGCCTCT
GGACAGTGCAACGTCCTCCTCCACCTTGACGTCGCCCTCCCGCCTTCACGCCTTCTGTGCCCTCCCCCCGGCAGCCATCT
CTGTCCTCGCCCCTCGCCGTCACCCCGCTGCCGCCGCCCATCTCGGCAACGGTCCCGGCCACATCTCCGTCGTCACCTCT
ACCGGCTTCCAGAAACTGACTCTCGACGCCTACCACGATGCCGTCGACGCCCTGCTGCCCGACATCGTCGTCCCTATGGC
TGACCTGACCTATGGTGGCCATGGCGGCCTGTCGTACCCGACGGCTAAGCGCGCTGTCCGCATGGCTGACCGCACCGAAG
ACTGGATCGACCAGTTTCTGTCGAGGACCACCAACACCGCTGACGGCCCTCACGTCTTCGCCCCAACTCTGCCGGTGCCT
TATGCGACACAGTGGCAGTACCTCAACGGCCTGGCCGACTGGATGACCGGCCAGGGCGACAGAAGCCCTCAGAAAGCCCT
CGCTGGCCTCGCCGTCTACGACGTCGACCTCCTGCCCGACCTGCGCGCCGACTACGACAACTCCCTCGCCCTGCTGCCGC
GCCTGTCGTTGCACCCCGCCCCCACCCCCCATCATATGTTGCGCCAGATTGCTCTCGGCGCCGACCTGATCGTCCTGCCT
GCCATCACTGCTGCCTCTGAAGCTGGCCTGGCATATACGTTCTCCTGGGATGTCGCTTTCCAGGCCGAGACTATGCCCTC
TGATCGCCCTCTTGATCCTCTCGATCCTCTCGATCCTCCCGACCATCCTGACCACTCTCCTGACCAAATCCTCCCCCTTG
CCGTCGACCTCTCTGATCCCTCACATGCTGCCTCTCTTCTGCCGCTCGCTCCCGGCTGCAGCTGTGCTGCTTGTGTCGCC
GGCCATCATCGCGCCTACGTCCACCACCTGCTCGACGCCCACGAGATGCTCGCCTGGACCCTCCTCCAGATCCACAACCA
CCATGTCGTCGACCGCCTCTTTGCCGCTGTCCGCGCCACCCTCGCTGACCCCGATCCCGATGCCTTTGAGCGCACCCGAC
GCCGCTTCCACCTCGCCTTCGCCCCTGACCTGCCGGTCGGCTCCGCTGTCCGTCCCCGCGCCCGCGGCTACCAGGCCGTC
AGCAATGGGCCCGTTGACAGCCGCCTCAACAAGCCTGCCTGGGGACGTCTGGAAGAGGTCGGCCATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62