GenePrediction:GLEAN_3690 Details

Name: GLEAN_3690
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:299835..302603 (+ strand)
Length: 2769
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:299835..300902 (+ strand)
Length: 1068
Type: CDS
Source: GLEAN
Position: GCSC_113:300962..302071 (+ strand)
Length: 1110
Type: CDS
Source: GLEAN
Position: GCSC_113:302136..302603 (+ strand)
Length: 468
>GLEAN_3690 class=GenePrediction position=GCSC_113:299835..302603 (+ strand)
ATGTGTCGCCACGCTCGAGCCGATGGCGATGGCAGTGCCACCATCGTGAATGCTGGCCGTGAGCTTCTGCCGGCCGATGT
AGTGCCCCAGCACTACGACCTCACGCTCGAGACGGACTTCGAGAAGCTTACTTTTGAGGGTTCCGTCGTCATCGATCTCG
ACGTGGTCAAGGACACCAACTCGGTCTCTCTCCACACCGTCGACCTCGAAGTCCACAGCGTAAAGGTGTTGGGCGATGGG
GCTCTCGTCAGCGATGCTCCCACTGTCTCCTACACGGCCGACACCCAAACCACCAAGATTGATTTTGATGGCGGCCTGAC
TAAGGGCACCAAGGCCCAGCTCGCAATCGTTTTCACCGGCCAGCTCAACGACAAGATGGCTGGCTTCTACCGCTCGACCT
TTAAGAAGGCCGACGGCACGGATGGCATCATGGCTGTCTCTCAGATGGAGCCTACTGATGCCCGCCGTGCCTTTCCCTGC
TTTGACGAGCCCTCGCTCAAGGCCGCCTTCACCGTCACTTTGATTGCTGACAAGCACCTGACCTGCTTGAGTAACATGGA
CGTCGCGTCCGAGACCGAGATCACGTCTACCGTCACCGGCACCACCAAGAAGGCTGTCAAGTTCAACGTCTCGCCGCGCA
TGTCTACTTACCTCGTTGCCTTTATTGTCGGCGAGCTGAACTACATCGAGACGAACTCGTTCCGCGTCCCCGTGCGCGTC
TACGCCCCGACCGGCCAGAACATCGAGAACGGCCGGTTCTCGCTCGAGCTTGCTGCCCGCACGCTTGCGTTCTACGAGAA
GGTCTTTGGCATCGACTTTCCCCTACCCAAGATGGACCAGATCGCCATCCCCGACTTTGCTCAGGGCGCCATGGAGAACT
GGGGTCTCGTGACCTACCGTGTCGTTGATCTGCTGCTGGACGAAAAGACCAGCGGTGCTGCCACAAAGGAGCGTGTCGCC
GAGGTCGTCCAGCACGAGCTTGCCCACCAGTGGTTCGGCAACCTGGTCACCATGGATTGGTGGGACGGCCTCTGGCTGAA
CGAGGGCTTTGCCACCTGGGCGTCTTGGGTTCGTTCTGCCTTCTCCCTTGTCTCTACTGTTCGAATGCACGGAACTAACG
AAAAAAGTACTCCTGCAACGTCTTCTTCCCCGAATGGAAGGTGTGGGAGTCGTACGTCACCGATACCCTCCAGGGTGCGC
TGTCGCTTGACTCCCTTCGCAGCAGCCACCCGATCGAGGTGCCGGTCAAGCGCGCCGATGAGATCAACCAGATCTTTGAC
GCCATCTCCTACTCCAAGGGCTCGTGTGTCCTGCGCATGATTTCGACATACATTGGCGAAGATGCCTTCTTGGAGGGCGT
CCGCCGCTACCTGAAGAAACACGCGTATGGCAACACGCAGACGGGCGATCTATGGGCTTCTCTGGCCGAGGCCAGCGGCA
AGCCTGTAGACGAGGTCATGACCGTGTGGACGAAGAATGTTGGCTACCCTGTCGTGACTGTGACTGAGGGCGACAACAAG
GTGCACCTGAAGCAGAACCGGTTCCTCCGCACGGGTGATGTGAAGCCGGAAGAGGACGACGTACTATACCCGGTCCTTTT
GGGCGTTCGGACCAAGGACGGCGTGGACGAGGCGCCGATACTGGACAAGCGCGAGGATGTGCTCGAGCTGTCGAGCCTGG
ATTTCTTCAAGCTCAACGCAAACCACACGGGCCTTTACCGCACTGCCTACTCGCCCGACCGTCTGGCAAAGCTTGGCCAA
GCGGCAAAGGACGGCCTCCTGTCGGTGGAGGATCGTGCAGGCATGGTTGCTGACGCTGGCGCCCTGGCCATCTCGGGCTA
TCAAAAGACGTCGGGCGTTTTGAGCCTGCTCAAGTCGTTCACCGCCGAGACGGAGTTTGTTGTCTGGAATGAGCTGATCT
CGCGCTTGTCGGCCATCCAGGGTGCGTGGATCTTCGAGGACGAGGCAACGCGCAACAGTCTGGAGGCGTTCCAGCGCGAC
CTTGTGAGCGCCAAGGCCCACACACTGGGCTGGACGTTCTCCGACTCGGACGGCCACATCGAGCAGCAGTTCAAGGCAAT
GCTGTTCGGCAGCGCCGGACTGAACGGCGACAAGACCATCATCGCAGCGGCCAAGGACATGTTCAAGCGGTTCTTCGCCG
GCGACAGCCTGGCCATCCACCCCAACATCCGTGGCAGCGTGTTTGGCATGGCCTTGAAGTACGGCGGCAAGGAAGAGGTA
AGTGCTTCGTGTTTCCTCCTATCTTAGAGGCGAGCCTGTGCTGACTAAGTGCCATCGACAGTATGATACTATTATCAACT
TTTACCGCACCTCGAAGAACAGCGACGAGCGGAACACGGCTCTGCGGTCTCTGGGCCGGGCCACGGACCCGGAGCTCATT
AAGCGCACATTGGAGCTTCTGAACGGCACAGAGATCAAGGACCAGGACATCTACATGCCTGCGTCAGGCCTGCGTGGCCA
CCCCGCCGGAATCGAGGCGTTGTTCGGCTGGCTGACGGAGAATTGGGACGAGGTGTACAAGCGCTTCCCGCCCGGCTTGT
CGATGCTCGGCTCGCTGGTCAGCATCATGACGTCGAGCTTCTCGCAGCCGGAACAGATTGCCCGTGTCGAGGCCTTTTTT
GCCGACAAGAACACCAAGGGTTACGATCAGGCCCTGGCCCAGAGCCTGGATGCCATCCGCTCGAAGATTGCATGGATCAA
GCGGGACGGCGACGACGTCTCTGGCTGGTTGCATGAGAACGGCTACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62