GenePrediction:GLEAN_3692 Details

Name: GLEAN_3692
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:313836..314557 (+ strand)
Length: 722
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:313836..314379 (+ strand)
Length: 544
Type: CDS
Source: GLEAN
Position: GCSC_113:314493..314557 (+ strand)
Length: 65
>GLEAN_3692 class=GenePrediction position=GCSC_113:313836..314557 (+ strand)
ATGGTGTCGGCGGAGTTCGAGGCCATGACAACGCTCTATCAGGTCATGCCGGAGATTGTCGCAGAGCCTCTGGCATGGGG
TGGATATGAGATGGAAAATGATACGTGGTTCTACATTTGTCGTTTTCACGAACTTTCTGAAGATATCCCCGACGTCTCCG
ACTTTCCCGCCCTTTTGGCCGAGCTGCACAAGAGAGGAGGAGCAAACGAAACTGAGTTCGGGTTTCCTATCACAACATAT
GGAGGCCGTAATCGACGCACGTTTCCGGTCTCCAAGAGTTGGGAAGAAACTTTCTCGAAGGGGCTGCATAATACGTTTGA
TATTGAGGAAGAAACGCAGGGAAAACCCGAGGAGATGACGTCCCTGCGCAAGGAGTTTGTGGCTAAAATCGTGCCTCGTC
TTCTGCGTCCTCTGGAAACAGAGGGCCGGAAGCTGACGCCGGCACTCGTGCATGGCGATATCTGGGATGGAAATGCGTCT
GTCGATGTGCAGACAGGTTTGCCCCTGATATTTGATGCAACGCCAATGTATGCCCACAACGAATGTATGTCGACTAGGTC
TTGGTGCCTCATTGTTTGACCATCCGCGATTTAGACTGACGATACTTCTTAGACGATTTAGCCCCATGGTGAATACCACG
CCACAAAATGACCGAAGCGTACATCGACGAATACGTCAAACACTACCCGATATCTGCTCAACAAATATCCTCTCGGGTAT
AA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62