GenePrediction:GLEAN_3693 Details

Name: GLEAN_3693
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:315108..316628 (+ strand)
Length: 1521
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:315108..315935 (+ strand)
Length: 828
Type: CDS
Source: GLEAN
Position: GCSC_113:316026..316628 (+ strand)
Length: 603
>GLEAN_3693 class=GenePrediction position=GCSC_113:315108..316628 (+ strand)
ATGGCCACTAAAAACAGTGGCCCAGTCGTGGCCTCTGTGGCATTAGAAGAGGGGGATGCAGAAAAGGTGGCCAGCCACAC
CGCTGATCTGACCTCCGTCTCAGCCGATGCAGGGCCACCATACACCGTTTTCAGCCTGCGCACCCGCTGGCTAATCGTGG
TCCTTCTCGGCTATTTGGGCCTGGCCTCGACGCTGACGGCCAACATCTACTTCCCGCTGCTAGACCTCTTGGCGGCCCGT
TACGCCGTCTCGCCCCAGGCCATCAACCTGACGATCACGCTCTACTTTGTCGTCCAGGGCATCGCGCCGTCTTTCTGGTC
GCCGCTGTCGGACCGCGTCGGCCGCCGGCCCATCTTCCTGGCCACCTTTATCGTCTACACGCTGGCATCAGCCGGCCTTT
CTGCCGCCCCCAGCAACAGCTACGCGGTCCTGCTCCTGTTGCGGGCCATGCAGAGTGTTGGCGCATCCGCGGTGCTGTCC
ATGGCATACGCAGCCGTGGCCGACGTGACCGTGCACACCGGCCGCGGGTGCTTCCTGGCGCCCATGATGACGGCCGTCAA
CATCGGCACCTGCGTCGGGCCCGTGGTCGGTGGCGCGGCCGTGTTGCGCTCGGGCGACCCGCGCTGGTGCTTTCGCACGC
TGCTGGCGTTTGGCGCCTCAGGCTTTCTCCTCATCGGTCTGGCGCTGCCCGAGACGGCACGGTCTGTCGTCGGCAACGGC
TCGACGGCTGCACGGGGCCTGTGTCGGACCTGGTGGTCTATGGCACACATACACGCGAGGCCGTCCCGAATCAAGGCCAC
CTCCAAAGGCCAGACGAGGCGCTGCACTGTCCCTCATCCCTTTGGTGCTCTGCGGATGCTGTTCTATCCGGACATGTTGC
TGACACTGTAGCTAGCCAGCTCTTCCTATGCTCTGTAGTTCTGCGTTCAGACGTCCATCTCGCCCGCCTTTTCGCGCATC
TACGGCTTCGACCCGCTGCAGGTCGGCCTCTGCTTCCTAGCTGGTGGTGCTGGAATTCTGGCCGGTGGCCTCATCGCCAG
TCGGCTGCTCGACCACAACTACCGCCACATGGCACGCAACTGTGGCCTGCCGGTCGATCGTGTCCGCGGCCTCGACAGCG
TCGCGCACTTTCCGCTGGAACATGCTCGCACGCACGGATCTGTGCGCATCCTGACGATCTCGCTGGCCGCCGTCGTCGGC
TACGGCTGGGTTCTCGACCAGCCGCATGGCCACATCCATCCAGCCGTACCGCTGCTCCTGCAGGCCTTTCTCGCCTGCAA
GTGCACCATACTGCTACAGACCTACAGCGCACTCGCCGTCGACGTGTTCCCCAAGAGAACCGGCACCGCCGCTGCCGCCA
ATAATATCACCCGCTGCCTGCTGGCGGCTGGCGCTGTCGCTGCGCTCGATCCGCTGGCACAGGCACTCGGCTACGGCTGG
GTCTTCACGCTTCTGGGACTGCTAGATGCCGTCGCCGGCGTGGCTGCCGTTCTGGCGCTGCGCCGCTGGGGACCGTTGTA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62