GenePrediction:GLEAN_3696 Details

Name: GLEAN_3696
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:350982..351909 (+ strand)
Length: 928
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:350982..351068 (+ strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_113:351155..351359 (+ strand)
Length: 205
Type: CDS
Source: GLEAN
Position: GCSC_113:351419..351909 (+ strand)
Length: 491
>GLEAN_3696 class=GenePrediction position=GCSC_113:350982..351909 (+ strand)
ATGCGTGCCTCTATCCTGCTCTCGGCCATCTTCATTGCTATTGCTGCGGCTCGGGTTGCAATTTCAGAAGATGGCCCAAT
AACGGGTGTACGTGCTATACTCCCCGCAAAGGATATTGCTTTATTTTCTATACCATCGTATGTTGTGCTCTAGACTGACA
GAAGCCGTAATAGGCTCTAGGAAGCGCTACGGTGACCGCAGACAACCCGCCCGGCCAAGTTTATATCGCCACTCTCCCAA
AAACAGCCTTTGACAAGGCAGCATACCCGTCTGGAGGCAATGTGGAGGGTCGCATCTCTGCCGAAGCACATCCTGGTGGC
ATTGGCGTTGACTTTGATATCAACTTCTGGAATCTACCCGAGACTGATGGTCCTTTCAGTATGTCTAAGCGTTGTCTATG
CTTCTATTGTAAGAGAGAGTCTGCTAACCTGCCACAGCCTATCACATTCATGAGTTTCCTGTGCCAATCGACGGCAATTG
CATCGCTACTGGAGGCCATCTCGATCCTTTTAGGCGAGAGGATGATCCCGCTTGCGACAGCAAGCTCAAGCAGACTTGCG
AGGTCGGTGATCTCAGTGGCAAGCATAGTAAAATCACTTCAGACCCGTTCATCGCTACCTACCGTGACCTTTACACATCC
ACCAAGCCTGGAAACCCGGCTTTCTTTGGCAACCTCAGCTTCGTGCTGCACTACTCCAACAAGACACGCATCACTTGTGC
CAACTTCATTCTGCAAAATGCATCCTACACATCCACCGACAATGGCACGGCAACCGCTACGCCGTACCCTTCGTCCAGCT
CGGTATCGCCAAAGGTTCCCATGCCTTCTGGCACAGCATCGGGGGCAGCTAGTTCGTTTCCGAAAGCGGCCATCGTTGGC
GTCGGCGTGGCCGCCGTTTTGGAGGCAGCTATGATACTGTTTATGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62